GenePrediction:GLEAN_3973 Details

Name: GLEAN_3973
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2016714..2017592 (+ strand)
Length: 879
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2016714..2017238 (+ strand)
Length: 525
Type: CDS
Source: GLEAN
Position: GCSC_113:2017569..2017592 (+ strand)
Length: 24
>GLEAN_3973 class=GenePrediction position=GCSC_113:2016714..2017592 (+ strand)
ATGGAAATGCTGCCACAGCCATCCGGTGGCTCTGCACGCTCTCGGCATGGCGAGCATTCTTCCTCCGGTGAGAGCAGCCG
TGGCAAGTTTGGAATCTCGGCCGTAAAATACCGAGTTGGCGCGCCACCTCTTCCCCCGCTTCCGTATAAATACGAATGCT
ACGGCGTGCCGAAGATCCAAGAGCTTGAAGCCCGGTTTGGAGACATCTTTGCGCGGCAGGCAGAGGCCACCTTGCATCAC
CACCAGATCACCCTCTTCCAACCGGAGGAAGAATATGAAGAAATTAATGTAGGGATTGATCCGGGATTCTATGCGGACTG
CGAAAATCAGCCCACCCTCTGCCAGCGATCTCTGCCGGAGACAGAGGACAGCGAAATTGTGCTTTCCATCATCGTCAACT
GGGAGGCAGATTCTCTACAAGCCTGGGAGGCGGCCATCAGGGACATCAAAAGTTTTATCGACCAAAAGCTGGATGATGCC
GGGCTTGATTGTTTTGAAATTGGAGTCGAAATCATGGCGCCTGAGGTCCGATTGAAAAGTGTGAAGCTCTAGAATGGAGC
GCACTGTGATCGTTCTGACTAATGCCAGCAACGCGGCCTCTCATTGGGCAGACAGATAAAAATGGGGACTAGCCCCAGTG
AAATCTCTGCACCAGTAAAGGCGCGCCATGTACTCTCTCCTAGCTAGTTACAACACGCAGATCATCAGCCACATCGTGAA
GACCCATACAGTGTACCGCTACCCCTGCCATAAGCATCAGTTGTGACAAAAAGGTACACCAGAATTGTGGAATACAATGC
GGATCTCATACGGGACTGGCCCGGCATCAAGGACCATGTGTTTTCTGTGCTACAGCTATTCAACAGTACCAAGGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62