GenePrediction:GLEAN_3975 Details

Name: GLEAN_3975
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2027192..2030213 (+ strand)
Length: 3022
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2027192..2028607 (+ strand)
Length: 1416
Type: CDS
Source: GLEAN
Position: GCSC_113:2028659..2029649 (+ strand)
Length: 991
Type: CDS
Source: GLEAN
Position: GCSC_113:2029774..2030213 (+ strand)
Length: 440
>GLEAN_3975 class=GenePrediction position=GCSC_113:2027192..2030213 (+ strand)
ATGAAGCCCTTCTGCAGTCTTGTAGCCTTAGCTGGACTAGCCAGCTTGGGTGTTGCTCTGGTACCGCAGCCATTCAATGC
CAAAATTGAAGATACTGGGCCGTGGGCAGTTAACTTGGACATTAGCTCTCATTCTTTCCTCAAGGCTAGGAGTCTGCCGA
CTGGCACATGCAATGCCGAAACCCCTTACGAAAATGATGCATGCTGCGGCAGTGATAACCTCTGTGGCTATTCGCCCAAG
TCTTGCAGCACAGGGTGTCAGCACAATTGTGAGTGTCTTTATACTGTATCTTGTTACATTCACTTATTGACAATGTCTCC
AGGCGACGCGAAAGCAGAATGCGGCCCATATGCAGCGGAGGGTGAACAGAAATGCCCACTCAATGTGTGCTGCTCGGAAT
TTGGCTTTTGTGGATCAACGTCCGAGTTCTGCACTTGGAATAACACGGCAGACCCGAATTATTCCAAATGCGATACTGCA
TATGGCGGCTGTGGCTCTGTAGACAAACCGTCATGCTCCTCTGGTGGAAATGGGGCTTCCAAGCGCAACATTGGCTACTA
CGAGTCGTGGGCCAACACGAGGACATGCCAAAATGTGGCTCCCGAAGATCTGAACCTGGATGGTTTCACCTCGATCAACT
TTGCTTTTGCCTTCTTCGATCCGGCATCCTTCACCATCACGTCTATGGACTCTAATGCTGCTTCTCTTTGCAGCCGATTT
ACAGCATTAAAGGATAAGAAGCCGGGATTGAAGACCTACATCTCCGTCGGCGGTTGGTCGTTTACGGACCCCGGCGCCAC
CCAGAAGGCCTTTAGCAACATGGCCAGCTCGTCGGGTAATCGCGAGAAGTTCATTAACGGTCTTGTCAACTTCATGGACA
CATTTGGCTTCGATGGTGTTGACCTTGACTGGGAATATCCGGGTGCCGATGATCGCGGAGGCGTGGAATCCGACACGGCC
AACTATGTCGCTCTCGTGGAGCAGATGCGTCAAGCCTTCGGGACCAAATACGGGCTTACTGTCACAATCCCTACATCATA
CTGGTACCTGCAACACTTTGACGTCGAGAGCATGCAGACCCACATCGACTGGTTCAATCTGATGGCCTATGACCTGCACG
GTACCTGGGATGCGCAGTCCAAGTATGTTGGGCCCTACATTGCCCCACACACCAATATCATCGAGATCGATGCCGCGCTG
GATCTGTTGTGGCGTGCAGGTGTGGATTCAAAAAACGTCGTCCTGGGACAGGGTTGGTATGGCCGCAGCTTTACTCTCAA
AGACTCGAGCTGTAGCACTCCCAACGGAATGTGTGAGTTCAAAGGCGGGGCCGACCCTGGCCCTTGTTCCAAGGCAGCCG
GTATTTTGGACTGCGAGGGGATTGCGGACATCGTTTCCAAGAATAATCTCGACCCTGTTTGGGACAAAGACGCGGCTGTT
AAATGGATCCACTGAAACAACGACCAGTGGGTGTCGTATGACGACAAGGACACATTCAAGCAGAAGAGAGACTTTGCCAA
CAAACGCTGTCTTGGTGGACTCATGGTTTGGGCCATGGATCAGGTCGATCAGACAGCGGAGAATGGTTTTGGCGGCGCGG
CAGCAGCGGCTGGTGCCGCCGTGTCCTTAAGTCAGCAGAAAGATGCCAATAGCAAATCTAGCGACATGCTGGCTGGGTTG
AAATGCTACGTGTCCGATTGCACTTCTTCATGCAAGGCTGGGACGGTGCAGGTGGCGCAATTCAATGGTCAGCCAGGCCA
AATTAGCACTAGCCAACGCTGCAGCAAAAAGAAATACAGAAGCCTGTGTTGCGACTCCTCAACCACCATGGGGACCTGCC
AGTGGCGTGGCTATCGTGGTGCCGGCCTGTCTTGCATCAAAGGCTGCGCCGATGGTGAGACTGAGCTGACGACCAACACC
AACGAACATGAGAGCAAGAAGGGGGACAAGAACTGCCACGGAGGACTGCAAAGTTTCTGCTGTTCCGGCTACAAGCCTAC
GTCGTCGAGTCTGGAGGATGACCTGAAAGATGCAGCCAAAGCAGCAGCCGAGGCGGCGGCCGAGCAAGCTGCCCTAGATT
TGGCGGCGAAGGCTTTCTGCAGGGTGGCAGTGCCAGCTCTGTTGGCACCTCTGGAGCTATTGGAAGACCTCATCCCCATT
ATCGGCGAGATTGCCGATGCCATCGAGATTGCAGCCACTCCCGGAATCATCGAAGGGTGCGTCAAAGGGATCGAGAAGGA
AGGCAAGGCCGAGTTCAAGGTGTTTGGCAAGAAGCACACACTGTCCATAAACTCGCCCACCACCAAGGCCACAACCGTGC
CCTCCCGTGACGACCCAAAAGGCGACAATCCGTCAAAAACCGGGGACAAGAATGGAAAATGCACCTGTGTGGCCAAGCGC
GCTCCAGCTGTTCCAACCGAGACCACGTTCAAGAACTCAGAACGCATGGGGTTTCTTTGTCCAGTCAAGTCGACGGCCTC
GCGACTACCAGTGGAGAGACAAAGAAGGATACGCACTTCGTGTCATGCTACCCAAGCAGTACACGTCGAACATGTTTCCC
AAACATTACGGACTCGTGGCAGGCTATGTGCACTGGAATTCCCCAGAAAAGACGACAGTGAAAGAATGCGGAGAAGTCGT
GCGAGAGAAGCACGTAACTACACGAGATTGGTGGTCTAATGGATATGACCTTTATTACGAAAATGTTGACGGCAAGAAAA
TAATACACGCCGGTGGACCAGAACTCTTAATAAGAGATGGCGAGGGTAAGGTCACCAAAAACACTAATATCGGATCCATT
GGATCTCGTGGTATGACTTGGACTGGTGATACCACTTTCGATAAATCCTACGCAGTGTGGCAAGATATGGGACCTATCAG
AGATGGTATCAAATACAGCGAGGCTAAGAAAGCCGCCGAAGTTTACGCGCAGAAGTATGAAGAATACGGCTATTTCACGA
ATAACTGTTACCAGTATGCGAACAATCTGTACTATTGGATGGTGGACGGAATAGAGCGATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62