GenePrediction:GLEAN_3977 Details

Name: GLEAN_3977
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2039813..2040759 (+ strand)
Length: 947
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2039813..2040076 (+ strand)
Length: 264
Type: CDS
Source: GLEAN
Position: GCSC_113:2040166..2040759 (+ strand)
Length: 594
>GLEAN_3977 class=GenePrediction position=GCSC_113:2039813..2040759 (+ strand)
ATGGCCTCTTTTTTGTGTCTCGTACGCTTTCGTGACGAAAACGGCGACGTTCACTTCGGCGAAGCCGGCCTAGCACCCTG
CCACTCCCAGGCGATTCTCGTGGGGCGTAAGGTTCCTGTGTTCCGCGGCAAGGAGCCGTGGGACTCCGACTTCGTCTTGA
CTGAAGAGGAGCACACGATTCAAGAGGTGCTTAGCCCCTTGGCCCGCACGCCCATTTTCGAATGCATTGGTCTGAACTAC
AAGCAACACGCAAAGGAGGCAAATGTAAGTGAGAGGCTGCGCAATTGGAAGGGACTGCGGAAGACAGCCTTCTCCTCAGG
CAAAGGAAATTGCTACTCACAAGCCTGCAACAGACCTCCTATGGCGAGTATCCAACGGTCTTCACGAAGCCCCCAGATGC
CATGGCTGGCCCCTACGAGGATATTCCCATCCATCCGTCATGTCTCCACCTAGACTACGAAGCCGAGCTGTGTGTCGTGA
TCAAGAAGGACTGCAAGAATCTGACAGAGGCCGACGACATCACCGACTACATCCTAGGCTACACGGCAGGGAATGACGTG
TCATCCCGCTGGTGGCAGATGCCGGCTCGGTCAAACAACCAGCACGGAGTGGCCAAGTCTTTTGACAAGTTTGCGCCATT
AGGACCGGTGCTAGCTTCGCCGCGTGCTGTTCCCGATCCTAAAAAGCTACACATGGAGTGCTTTGTCAATGGCGAGCGGC
GGCAAGAGACGGGCATCGATGACCAGATCTACGACATCAGTACTGTTCTGCGCCATCTATCACGGGGTATGACACTACGT
CGTGGGACCGTCATAATGACCGGGACTCCCAGCGGCGTGGCCGCGTTCAGGCAACCGCCTGTGTGGCTGCAGCACGGCGA
CGTTGTGACTGTGCGGATCGATGTGATTGGGGAGATTTTAAATCACATGGCCTTCGAAAATAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62