GenePrediction:GLEAN_3979 Details

Name: GLEAN_3979
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2048027..2051772 (+ strand)
Length: 3746
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2048027..2048078 (+ strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_113:2048147..2048342 (+ strand)
Length: 196
Type: CDS
Source: GLEAN
Position: GCSC_113:2048391..2048895 (+ strand)
Length: 505
Type: CDS
Source: GLEAN
Position: GCSC_113:2048964..2049945 (+ strand)
Length: 982
Type: CDS
Source: GLEAN
Position: GCSC_113:2050004..2051772 (+ strand)
Length: 1769
>GLEAN_3979 class=GenePrediction position=GCSC_113:2048027..2051772 (+ strand)
ATGGAAGCTCCTAACCCGACAGTCGATCTCCATTGGGGGGAATTTCGTGGAGGTAGGATGTCATAATCCCTTCTCGTTCC
TCCTCCTTTCTTGGGCACCGTCTTACCTCATCTCGCGTAGCTATCCACGAGATCTTTGCCCAGAATGCCAAGAAGTTCCC
CGACAGAGAGTGTGTCGTGGAAACCAAGAGCTCTCGCACCAAGGAGCGCGTCTTCACATACCGGCAGATCAACGAGAGCG
CCAATCTGCTGGCACACCACCTCCTGGACCATGGATGTGCAGTGGGCGATGTCGTCATGATATATGCATACCGAGGGTCT
GTTGATCTCCTCTTTTTCGTGCTTGCAGCTGCTGACTGATAAAGAGTCGACCTCGTGGTGGCCTATATGGGTGCTCTCAA
AGCCGGTGCGACCGTCAGCGTGATCGATCCGCAGTACCCTCCCGAACGGCAGAAGGTGCTGCTGGACATTGCGAGGCCCA
AGTTCCTTGTTTGCATCGAAATGGCGAACAAGGAATCCGGTCCGCTTTCGGAGGCCGTTCTGGACTTTGTCGCAAGCAGC
TTGAGCCTCAAGTCGTCCATTCCTGCTCTCGCCCTATGCGACAACGGAGAGCTGCGCGGAGGTATCGTCAACGGCAAGGA
CTGCCTAGATGCCTCAGTCTACAGCCGCGAGGACCCAGTCAATGTCGTCGTAGGGCCGGAGTCAGTCCCTACTCTGTCGT
ACACCAGCGGTTCGGAAGGCCGGCCGAAGGGTGTGTTGGGCCGGCACTTCTCCCTGACGCACTACTTTCCTTGGATGGCG
GAACGATTTGGCCTTTCGGACCAAGACAGGTTCACGATGCTGTCTGGAATCGCTCATGATCCAATTCAGGTGGGTTGCAG
CTCGTTGTCGGCGATACCGGGGGGGTTCACTACAGATGGTCTAACGAGCTGGTATAGCGAGACATTTTTACGCCACTCTT
TTTGGGTGCCAAGATCATCGTTCCTCCGATGGACGTGATCGCCTACGAGCTTCTGGCCGAATGGATGAAGGAGAGCCGCG
TCACGGTGACGCACTTGACTCCCGCCATGGGGCAGATCCTTGTGGGAGGCGCCACCGCCTTGATCTCCTCTCTCCGAAAT
GCTTTCTTCGTGGGCGACCTATTGACCAAGAAGGACACGGCGAAGCTGCGGAACCTGGCGCCGGGTGCGAGTGTCATCAA
TCTTTACGGATCGACCGAAAGCCAACGGGCGGTCTCTTACTTGGAGATTCCGAGCAAGGCCCGGGATCCTCTGTTCCTAG
ACAGCCTTCCCGACATTATACCGGTCGGGCAGGGCATGCTCAATGTCCAGCTCTTGGTGGTGGACCGGGATAACCCGAAG
CGGCTGTGTGATGTTGGTGAGCAGGGAGAGCTGTTTTTGCGAGCTGGCGGTCTCGCCAAGGGATACCTCGGAGACGACGA
GAAGACGGCGGAGCTGAACCGGTCCAAGTTTCTGGCCAACTGGTTCGTCGATTCTCCCGTGCCGCAGGATCGTCTGTACA
AGACCGGCGACCTTGGCCGGCGCCGGCCTGACGGAAGCGTCGAGTGCACGGGCAGAATCGATTCGCAGGTCAAGATCCGT
GGTTTTCGCATCGAGCTGGGAGAAATCGACGCCCACCTGTCACAACACCCTTATCTTCGCGAGAACGTCACATTGGTGCG
GAGAGACAAGAACGAGGAGCACACGCTCGTCACCTATTTCGTTCCCGAGACCAAGCGTTGGTTCCAACATCTCCAGCAAC
AAGGCGGACAGCTCCAGGTGCATTCTCCGGACGAGTCGATCAGCCAGATGCTTCGACAATTCAAGTCCCTGTCTGAGGAC
TGCAAGAAGTTCCTTGCTACCAGACTCCCTAAATATGCTGTTCCCAGCCTGTTCATCCCTTTAGCTCGGATGCCATTGAG
TACGTTTCTTTACTGCATGAAAGCCTTGCTTCTGGACATCATATTAACTTCTTGAAGATCCCAATGGAAAGATCGACAAA
GCCGCGCTCCCGTTCCCAGATGAGGCAGACCTCAGCTTCCTATCCAAGAGGAGAGCGTCGTCCGTGTCTGTCAACATGAC
CGAGACCCAGAAGACTCTAGCGTCAATCTGGGCGTCGGTGCTTCCCAACTGCTCCGCACGGATGCTCAGACCGGAGTCCA
ACTTTTTCGATGAAGGAGGACACTCGATTCTCGCGCAGCAGATGTTTTTCCGCATCAACAAAGAATGGAAGCACACCGAT
GTGCCCATTCGAGCAATTTTCCAGTCCCAGACGCTGGAGGCGCTTGCTGCCGAGATTGACCGTGCCCAAGACCCCATCGG
CCTGCGTCTGGATGCGATGCCTCTGGATGTCGACGCCAAGGGCCAGGACGAGGCGTATGCCGTGGACGCGCGCGACCTCG
CCGGTCAGCTTCCCAAGACCATCCCCACAGCAGCAACGACGTGGGATTCTGCCTCGGCCGCCCCTACGGTGCTCCTGACC
GGTGCCACTGGCTTCCTGGGCTCCTACATCGTGCACGAACTGCTCGAGGGTCCTACCCAGGCCAACGTGGTGGCAGTTGT
TCGTGCCAAAGATCCAGTGGCCGGGCTTGCCCGTTTGGAGACTGTCATGAAGGCCTACGGTCTCTGGTCTCCGGCATGGA
TCGCTTCGTCCAGGATCGAGGTTGTAGTCGGAGACCTGAGCAAGCCGCACATTGGCATTGATTCCAACACGTGGGAGCGC
CTAAGTAACACAGTCGATGTCGTCATCCACAACGGCGCCCAGGTGAACTGGATGCTGCCGTACTCGGTGATGCGGCCTGC
CAACGTGCTGAGCACACTAGCCTGCATCGAGCTGTGTGCTGTAGGCAAAAAGGCCAAGAGGCTGGCGTTTGTGAGCTCGA
CCTCGACACTCGACAACGACCACTACGTGCAGCTCTCGTCTGGCCCGGACGGAAAGCCGGTTCCCGAGGCCGACGATCTT
GAGGGCAGCCGCAAGGGCCTCGGCACTGGGTATGGACAGTCGAAGTGGGCGAGCGAGTATGTGCTGCGCGAGGCCGGACA
GCGTGGTCTTGTCGGTGCGATAATCCGCTCCGGCTACATCACGGGTGACCCTGCAACGGGCACCTCGGTGACAGACGACT
TCCTGGTCCGGCTCTGGAAGGGCTGTCTGCAGGTGGGCGGACGCCCTGACATTTCCAACACGCTCAACGCTGTTCCGGTC
ACACAGGTGAACCGCATCGTCGTCTCTGCGGCCTTCCACATGCCGAAGGCCACGGGCCAGAACATGGCGGTGGCCCAGGT
GACCAGCCATCCGCGTCTGACCCTGAACGACTGGATGGGCGCCCTGGAGGTGTATGGGTATGCGGCTGCACGCATTCCGT
ACCAGGATTGGGCCGCCAAGGTCAAGGATTACGTCAGCGACGATACCCAGACCGAGCCTCACGCTCTGTTGCCTCTCTTC
CATTTCGTCGTCGGGGACCTGCCAGGGAACACCATAGCGCCCGAGCTGGATGACACCAATGCTCTGGCAGCACTGGACCT
GTACGCAAAGGAAACAGTGACAAGAGGGGCTGCGCCGGCCTCGTCTGTCCATGCGGTCAATGCAGAGGCACTGGGTTCGT
ATTTGGCGTACCTCGTTGCTGTTGGGTTTATCCCTGCCCCTCCTGTCACAGCTGAGAGCGGTAAGACTCCGCTACCACAG
CTGAGCGAAGCTGCGTTACAGAACATAGCTGCCGGGCAGTTTGGTGGCAGGTCTGCCAAGCCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62