GenePrediction:GLEAN_397 Details

Name: GLEAN_397
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1536336..1540026 (+ strand)
Length: 3691
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1536336..1536431 (+ strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_167:1536494..1536718 (+ strand)
Length: 225
Type: CDS
Source: GLEAN
Position: GCSC_167:1536774..1536831 (+ strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_167:1536894..1536930 (+ strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_167:1537101..1537126 (+ strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_167:1537181..1537348 (+ strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_167:1537594..1537842 (+ strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_167:1537921..1538131 (+ strand)
Length: 211
Type: CDS
Source: GLEAN
Position: GCSC_167:1538200..1538417 (+ strand)
Length: 218
Type: CDS
Source: GLEAN
Position: GCSC_167:1538631..1538735 (+ strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_167:1538817..1538935 (+ strand)
Length: 119
Type: CDS
Source: GLEAN
Position: GCSC_167:1538999..1539322 (+ strand)
Length: 324
Type: CDS
Source: GLEAN
Position: GCSC_167:1539388..1540026 (+ strand)
Length: 639
>GLEAN_397 class=GenePrediction position=GCSC_167:1536336..1540026 (+ strand)
ATGGCAGCCAGCTCAGACATCCACTTGTACACTGCTCAGACGCCCAATGGCATCAAGGCGTCCATCCTACTGGAGGAGCT
GGGTCTGCCATACAAGGTGAGCTGTGTTCTGCTTGGCAAAGAAGGCCTCATCGCCTATTCTAATCACAAGACGATCAGGT
GACGGCAGTCGACATAAGCAAGAATGTCCAGAAGGAGCCATGGTTTCTCGCGATCAACCCCAACGGCCGCATCCCTGCTA
TGACGGACAAGTTCACCGATGGCTCGATTATCCGCCTCTTTGAGAGCGGCTCCATCCTCCAGTACCTGGTGGATCGCTAT
GACACTGAGCACAAGGTCTCATACCCCCAAGGTTCCAAGGAATACTACGAAGTGAACAACTGGGTAGGTCTGCCCCTCCG
CTTGAAGAGAGGGGTCTGTACACTAACAGATCACACAGCTCTTCTGGCAGATGGGAGGTCTAGGACCCATGCAGGGCCAG
GCCAACCATTTCTCCCGTGAGTGACGAGTCTGGATGAGGTGGAAGTAGTATGGTGTGCGGCTGACAACTTTTCCATAGGC
TATGCCCCTGAGAAGATCCAGTATGGTATTGACAGGTGAGTGCCATTCCAATTGCACCCGTTTTTTGCCTGGTCTCCGAT
TTTGACCGTCTCCCCCACAGATACCGAAATGAGACTCGACGCTTGTATCATGTTCTCGACACCCATCTTCTAGCATCCAA
GTCTGGCTTTATTGTTGGTGACAGACTGACCATTGCCGACATCAGTTGTTGGGGTTGGGTAGCTAGCCATCGTATGTCAC
TCCTTTTCATGTCGAATCAGCTTCCTTACTGACAAGTGCAACTAGACTGGGCTGGCATCGAGCTCGACGATATGCCCTCA
CTGAAGGCTTGGCTCCAGAAGCTGCTGCTTCGGCCAGGCCTAGAGAAGGGGCGCCACGTGCCAAGTCCCCACACTGTATT
GGAAATGGCAAGTCTCTCGGAGAAGGAGTTGGAGGAGAAGGCTGCAGCCGGACGTTCGTGGGTTCAACAGGGAATGGCCG
AAGATGCAAAGAAATGAACGACTTCTCTCTAGTGACGCATTTCCACTCGTACGTAGGCAATACCAGACGATAAATCACAC
TGTATGAAAACTTTAAGCACAATAAATAAGTAGGACTTTGAAGCGTGGCAACTTGTGAATGCTGGTGCTAAGTAAGAAGT
TAAACACGTGACCTCCAAACAACAATTTTTAAGAGGCGAACTTCAACCTCTTTTTCAGAAAGTCCTCTCTTCCACCTCAA
CCTCTCCGTGTCTCGCAAAACAACCACATATTCGCCAACCCAACATCCGACTTTCAAGATGGCTTGGCGGAATCAAGGAA
TCACGGGCTCGAACAATATCCCTTTGGGGAAGATGCGCCGCTTTGGCGCCGACGCGTCGCCCGAGGACGACCGCCATGGC
AGCAGCCGCGCCAGCGAACGTCCCAGCGAAGACCACGATCTGAAGCGCGGTCGCAGCCCCGAGCCGCGTAAGCTCCCAGC
CTGTTTCCATTGCATCGTCGAAAGTCCTTTATGCTTTTGCCCTAAAACTAACTTGCGCGTTGCAGGCATCGACGCGGACG
GAACGCGCCGACGCAGAAAGCGAAATCGTTGGGGCGAGGCATCGGACAACAAAGCGGCCGGCTTGATGGGCCTCCCGACT
GCTATCCTGGCGAACATGACAAGCGAGCAGCTCGAGGCTTACACCGTCCACCTGCGTATCGAGGAGATCACGCAGAAGCT
CAAGATCGATGATGTTGTGCCTGCGGAAGGAGACCGGTGAGCATCTGCCCCTTTCTTCGTCGGCTGTCTGAAGTGTTGCT
AACGCGTGTTTCTCCTCTGTCCAGGTCGCCGTCTCCTCCTCCTCAGTACGACAACCACGGTCGTCGCATTAACACCAGGG
AGTACCGATACAGAAAACGCCTCGAGGAAGAACGCCACAAGCTGGTGGAAAAGGCGTCCAAGATCTTCCCCAACTACCAC
CCTCCCCAGGACTACCGTCGGCCCACCAAGACCCAAGAGAAGGTCTATGTGCCTGTGAACGACTACCCGGAAATCAACTT
CAGTATGATAGCTAATCCTCTAACCTTTCTAACCCCCTCTCCCCCTCCCTTTTGTGCGCGTCGATTCTCTATGGTAATGC
TAGGCGCGTTAATACTTGCATGTTCTCCATGCAAGCCATTTCTGTGCTGAGATGACACCTAACCCAATCTAACGCTGCTT
TGCCTACACGATATAAATGACCGGATACTAACACTAACCTTTACTACTACTAAAGTCGGGTTACTCATTGGCCCTAGAGG
TAACACATTGAAGAAAATGGAGTCCGAGTCAGGAGCGAAAATCGCCATTCGTGGAAAGGGCTCGGTCAAGGAAGGCAAAG
GTACTTGGCGTCCGCGGTTCGGAGCCCCACGCCGGGCGCGTTTTAGGCATACGGAATACGTGCTGACCGGATATACGATA
GGTCGATCGGATGCTGCCCACTCGAGCAACCAGGAGGAAGACCTTCATTGCCTGATCATGGCCGATACGGAGGAGAAGGT
GGAGAAGGCCAAGGCGCTCATCCACAACGTCATTGAAACGGTGAGTCAGGAGTCTGCTTTCCTCTTCGTCAACAAGTGCA
AAGTGACTGACAGGACCACACAGGCCGCCTCCATTCCAGAAGGTCAAAACGAGCTGAAGCGTAAGCAGCTGCGCGAACTA
GCAACGCTGAACGGTACTCTGCGTGATGACGAAAACCAAGCCTGCCAGAATTGTGGACAGATTGGCCATCGCAAATACGA
CTGCCCCGAGAAGCAAAATTTTACAAACATCATAATATGCCGCGTGTGTGGCAATGCAGGACATATGGCTCGAGACTGTC
CCGAGCGTGCCAGAGGGACGAACTGGCGCAACGATGGGCCGCCTGTACGCCCTGCCGGCCGGCTGGGCCCCAGCAGTGGC
GGAGATGTCGTCGACCGCGAGTACGAGGTGAGTTGTCCCCCGACGTCATGTGTGCACACACCAAAAAGGCCTGTACTAAC
GAGTGCTTGCAGCAACTCATGCAAGAGATTGGAGGTGGCTCGAGCGCACCAGCACGGATCGAAGCCGGCCCTGGGTCTGC
CGGCAACGGAGACGGCAAGCCGTGGCAGCGAGGCCCAACAGGTGGACCGGCTCCTTGGCGACGAAGCAACGGCCGCGACT
CCGAGGGTGGTCCTGGCGGTCCCGGAGGGCCTGGCGGATCTGGCGGTCCTGCCCCATGGGCCCGTGATCGCGGCTACCGA
TCCAACGACAACCGCAACGGCGGCGACTACAACGGCGGCGGATCTGGAGGTGGATCTGGAGGCTATGGAGGCGAAGCGAA
CGGCGGAGGAAACGGCGGTGCTGCGCCCGGCCTTGCTCCGTGGCATCAGGCTCCAGGAGCCCAGTCTTATCCTGGCTACT
CCAGCTATGGTGCTCCGCCTCCTCCTCCTGGCATGGGTCCCCCTCCTGGACTTGCCCCTGCCGGGCTTCCTCCGCCACCT
GGTGCTCCCGGGTTGGGTCCTTCTGCCGGAGTTGCGAATGGTCTTAACGCTCTTATTCAGCAGTATTCTGGTTCAGGCGG
ACCTCAGCCACCACCTCCTCCTCCGCCAGGCGACGCTCCCCCGCCTCCTCCCAGCGATTTACCTCCTCCACCGCCTCCTC
CTGGGGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62