GenePrediction:GLEAN_3980 Details

Name: GLEAN_3980
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2054706..2056376 (+ strand)
Length: 1671
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2054706..2056376 (+ strand)
Length: 1671
>GLEAN_3980 class=GenePrediction position=GCSC_113:2054706..2056376 (+ strand)
ATGCCTTCCAGCATTCCCTACGACCCCAGCCTGTCTCTGGGCGGCGTCATCAACATAAAGGCTCTGCGGGTTTTAGAGGA
CATTTCGAACGAGCAGGCGCCGGTGGATGCGGCACAGGAGCACTTGAACTCGCTCATCATGTCGAAGCGGAGCATCGACA
TGACGCGGACGGAGCTGTCGAACCTGGGCATCGACACATGCGACCTGGACATGGAGATTGAGCGGCTCAATGGGGAGGTG
CAGCGGTCGGCCGTGGAATATGCCAAGACCAAGATTCGGGCGGAGGCCAAGATTAAGGACTTGCGCGGAAAAGTCCGGAC
CGTACACACGCAGGTGGAGAGCCCGGTGGACTTTGTCAAGTCGCAGATTAAGACGATGCCGCTGTCAGCAGACTCGCTCA
ACATGGACGTGCAGTACTTCACGTTGGACGACAACACGCAGAACGCGAAATCGGAAGCGACCAAGGCGGGTGCTTACGCG
TCATCCATCTCCAAGTTCGTGGCCAAGTCGACGTGCTGGATGGGTGGTGAGGCATCGCGGCAGATGAGCCGATCAGCACA
GACGCAGGTGCACGAGCAGATGAGCCGACACCGCATCATGGGTACGCTGGTCATCTCAGCATCGTGCACGCACAAAAATG
CGTCCATCATGGCGCCGCTGGGCCTTGACGTTGACAAGGGCATCAAGGTATGGAATCGGCTTTTCCCTGGAGACCGGCTC
GATGTGACAAATCGTCGTTGCATGGTAGACCTGGCTCATCAGATGCCCATAGTTCGTCCTGGAGGCCCCTGCGAGAACAA
GTTCAGCATTATCTCGGGCATGACGTTCGGGTCTAGCCTCGTTGGCATGGTGCACATCCTCAACAGCTCGACGACCAACG
TGTCCGAGAGGCTCTCAAGCATGGTCGAGACGTTGCAGGGTCAGATGGACGCCGGCGCGTGGTTCCAGCGCTGCAATGGT
GGCTTCGGCGTGACGGATACGATCGCCAATGATGTCAAGAGTATCATCAGCTCGCACCAAGTCACGTCGCACGTCACCAT
GGTCAGTATGGGCACGATTCCGTCGCTCGTGGCCAACGAGGTCAAGATCGGCGTCGACAAATTTGCCCAATTCGATCCCA
AGTCGTCGCTCGAGGCCATCGCGTCCATCCACAACGCAACTGCCGCTGATCAGGGTACCATCAAGCAGGCCGCCGATGCT
GCCCGCATCGGCCAGCAGATGGTCACGCTCAAGGCCGGCGAAATCAAGGCTGCCCTGACCGCCCTCTCTGAGATTGATGA
CGGCGCAAACAAGATGCTCGACATCAACTCCATGATGACCGCCCTTGAGGATTACCTGCGCAAAGCCGCCGAAGGCTCCG
CCGGTGTCCCTCTGACCTACTTCCTCAAGGATGTCACCAAGGACATGCTCGCCGAATTGTGGGTCGCCAAGTACTTCCCC
GGCGAGTATCTAGTCATCTGCTGCGATGACGACGACCGCCACGAACGGGGGAAGGACAGGGGCCGGAACACCCACCTTCT
CGGCTCTTCTAGCACTGCTGCCGCTGCTTCCGCAACGGCCTCTAGTAGCTCTTCTTCCGGTCCTACTCAAGGAAATGGTA
ACTATCGCTTTTCTGCGGGTGCGGGGGCTGCTGCTACTGCCTTAGGGGGTGAGGTGCTGATGAGAGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62