GenePrediction:GLEAN_3983 Details

Name: GLEAN_3983
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2071928..2073606 (+ strand)
Length: 1679
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2071928..2072145 (+ strand)
Length: 218
Type: CDS
Source: GLEAN
Position: GCSC_113:2072204..2073178 (+ strand)
Length: 975
Type: CDS
Source: GLEAN
Position: GCSC_113:2073246..2073606 (+ strand)
Length: 361
>GLEAN_3983 class=GenePrediction position=GCSC_113:2071928..2073606 (+ strand)
ATGGCTGCCGATGAGGAAACCATTGCGCCCGTTTCGGCGGTTGCCAAGAATGAAGATATCACCAAGGCGGGCGAAAAGGA
TGGCGTCCCCATCAGGGTGGTCTCGATCGACAATGGCCGAATTCTCGATAGCGCCGAGCCCGAGAAGGTTTACTACAGCA
AGGTGTCTGTCTGGTTCATGGTTCTCTTCTCGGGCCTGGCTATAGGCTCGGACGGATAGTAAGATGCTTCCGATTCTACT
GCAGTCTTGCTGCCGTTTGTGCTGACCAGTCCGCAGCAATGCCGGCGTGATTGGAAACCTGGAGCTGCTCCTAGCCGTCC
TTTATCCCGATACTCTCACCAATTCCATATACACGCGTCTTTCCAACTCCTTTCTGATCGGCATGATCCTCGGCATGCTC
AGCTTCGGAGTCGTGGTCGACCAGCTGGGCCGAAAGGCCGGTGCCGTTGCCACGACCATCATCCTCGTTCTCGGCATCGT
CCTGTCCACGGCCGCCAATGGGACGACGCCCACGGGCCTGCTCTGGATGCTCATTATCGCTCGTGGTGTAGCCGGCTTCG
GCGCCGGGGGAGAATATCCCGTGTCGGGTGCCGGTGCCGTCGAGGCGACAGATGAGCACGACAAGTACCGCAAGCGCCGT
GGCTTCATGTTCGCCATGCTTGCCGACCTGTCCTCTAGCCTGGGCTACGTCTGGGGTGGCCTCGTTCCCCTGCTGCTTCT
GCTGTGCGTGGACCAGAAGGAGAGCAAATACCACATCGTGTGGCGGACGTCGTTTGCCCTCGGCCTGGTCCCCCCTCTGG
CCATCTTCTGGTTCCGCATGCGCATGGCCGTCTCGACCGCGTACCGTCGCTCGGCCATGCGAAAGCAGCGCACGCCGTAT
TGGCTCGCGGCCAAACGCTATTGGCGGTCTCTGATCGGGGCTGCGGCCACTTGGTTCTTGTACAACTGGATCAGCATTCC
CTTTGGCATCTTCAGCTCGACCATCATCTCGCGCATGAACGAAAGTGATAGTCTGGTCAAGAACCTGGGCTGGGGCATCG
TCATCAACTGTTTCTACATCCCTGGTCCCTTCATCGGAGGCTATCTCTCGGATCGGATCGGCAGGAGACAGACAATGGCT
CTCGGCTTCGGTCTGCAGGCCGTCCTCGGCTTTGTCCTCGGTGGTGCCATGGGTCCTATCCAGAGCGTCTTCCCGCTATT
CATCGTTCTGTACGGCATCTTTTTGACCCTTGGCGAGGTTGGCCCAGGAAGGTGAGCTACATCTTCCTCTAGAGCTATTT
TCTGTCCTGGGTTTCGACTGACATTTCTGACTCCTCAGTACGGTCGTCATCACTGCATCCGAATGTTTCCCCACTTCAAT
CAGAGGCCAAATGATGGGATTTGTTTCGGCTTGGTCCAAGGCTGGAGCCGCCATCGGAACCCAGGTCTTCACGGCCATCC
AAAATTCGTACTCGGATAGTTCGTCCAAGGGAGACCAGGTCGCATTTCTTGTCGGCTCGGCGTTTGCCGTTCTCGGCGCA
CTTGTAGCGTACTTTGTCATTCCTGACGTTTCCACGCGGCTCGATGACGATGATCAGGCTTGGAAGCAATATCTTGCCGA
CAATGGATGGGAGGCAGACTGGGGCGATCATGAGACAAGGGATCCCACTGGTGTGGTTTTAAATCAAGTTGTGTCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62