GenePrediction:GLEAN_3988 Details

Name: GLEAN_3988
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2102723..2103789 (+ strand)
Length: 1067
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2102723..2102858 (+ strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_113:2102927..2103789 (+ strand)
Length: 863
>GLEAN_3988 class=GenePrediction position=GCSC_113:2102723..2103789 (+ strand)
ATGGCCTTGCTGCGTCAAATCAAGCTTCTTTTGACCTTTGGGTCGCTGGCCCTGGCTTCGGCTGTAACACGGACATCCGG
AAACGATGACGACGATGACGACGACGACACGCCTCTGCCGCTCGTCATCTGGCATGGTAACACATCTTTGGTCTGGTTCC
TTGATGGCTCTCTCGCTGACGCGTCTGCTCCCATCTCCCTGCAGGTCTTGGCGACAACTATGCGGCCGAAGGCCTCCGAA
AGGTGGGCGAGCTGGCTGACGAGATCAACCCGGGCACGCTCGTCTACTTTGTGCAGCTGGACGCCAGCGCGAGTGGCGAC
CGGTCGGCGACCTTTCTCGGCAACGTGACGGAGCAGGTGGCCAAAGTCTGCGACGACATTGCAGCAGATCCGATCCTGTC
GACGGCACCGGCTATTGATGCGCTCGGCTTCAGCCAGGGCGGCCAGTTTCTGCGAGCTTACGTCGAGCGGTGCAATCGGC
CACCGGTGCGGTCTCTCGTGACCTTTGGCTCGCAGCACAACGGCATCACCGAGTTTGTCGACTGCGGCGCCACCGACTTT
GTCTGTCGAGGTGCTATGGCTCTGCTGCGCGGTAACACTTGGTCTGGCTTCGTGCAGAGCCGCCTGGTGCCGGCGCAGTA
CTTCCGCGACCCGTCCACCCCCGAGCGCTACGTCCAGTACCTCGAGCACTCCAACCTGCTCGCTGACATCAACAACGAAC
GCGATGTCAAGAACACTACCTATCGCGACAACATGGCCCAACTGGCCAGCTTCGCCATGTACATGTTCGCCGAGGATGCC
ACCGTCATCCCCAAGGAGTCTGCTTGGTTTGCCGAGATCAACGGGACCGAGAACGTGCCTCTGCGCGCCCGCCCGCTCTA
CACGGAGGATTGGCTCGGCCTGCGCGCCCTCGACGACCAGGGCCGCCTGCACTTCCGCACCGTTCCTGGTGAGCACATGC
AGATTCGCGACAAGGACCTCGTCGCCGTCTTCTCTGACTTCTTCGGTCCCTTCAAGAAGACCATCACGCCGTCTCAGCAG
CTGCAAGATATGCCGGGCGAGCTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62