GenePrediction:GLEAN_398 Details

Name: GLEAN_398
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1540656..1543789 (+ strand)
Length: 3134
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1540656..1540963 (+ strand)
Length: 308
Type: CDS
Source: GLEAN
Position: GCSC_167:1541037..1542179 (+ strand)
Length: 1143
Type: CDS
Source: GLEAN
Position: GCSC_167:1542244..1543789 (+ strand)
Length: 1546
>GLEAN_398 class=GenePrediction position=GCSC_167:1540656..1543789 (+ strand)
ATGTTTCTCCCCAACCCCTTTGCCTTTCGGCCGGCCCAGGTGACCTTCTGGACGACCATCACGTATCTAGCTCTGCTCGT
GCCTATCATTTATCTCCAAGAGGCCGTCCCGGGCGCACCAGCAGAGTCGGCTCTGCCGCGGGGAATCAGCCTGTCGGAAG
CATGGGCCGACCTGGCTAACCTGACCGGAGCCTACCATCCGGCGAACAGCCATGCGAACGAGCTTGTTCGCAACTTTCTC
ATCCAGCGGATCCGCGAGATCCTCGACGACAACGGCGTGACCTGGACCACACAGGAGGACCGTGTCGGGTAAGCAGGAGC
ACAAGCGATTTATGTTTTGTCTGGCAGGGTTGCTAACGCTGTCATGTCATGCGTGTCTCAGCAATGCTGCTTCCCCGACA
GAAATCTCGGCGTCACGTGCCGGTGCTGGTGTGGATGCGGTTCTTTTTGACGACATGCGAGCCAACGTGACGTATACCAG
CAGCGGCTCCGACGGGACGCGGTCGGTGATGTACTATGAAGGCACGAATGTGTATGTCTACGTCCGTGGCACAGACGATG
CGCCCGGCGAGTGGTGGCAGCCGGGAGCCGAAGCTGGGCCCTCGGCGAAGCAACTTGTGCTGGTGAATGCGCACTACGAC
GCCGTGTCGTCCAGCTTTGGGGCCACCGACGATGGCGTCGGCGTGGTCACGTCGCTGCAGCTGCTGCGCTACTTCACGAC
ACCGGGGCACCAGCCGCGGCGTGGCATCGTCGTGCTGCTCAACAATGCCGAGGAGGACTTTCTGCTGGGCGCGAGCGCCT
TTGTCAACAGCCCGCTGGCGCCGTTTATCGGCTCGTTTGTCAACCTGGAGGGTGCCGGTGCCGGCGGCAAGGCGATGCTC
TTCCGCTCGACCGACCTGGAGGTCGTCAGCGCCTACAGGCGAAGCCCGCATCCGTTTGCGTCCGTGGTCGCCAGCGACAG
CTTCAAGTCCGGCCTGATCCGCAGCGAGACCGACTACCGCATCTGGGTGGACGTGCTGGGCTACCGCGGCCTCGACATTG
CCTTTTTCCGGCCCCGTGCCCGATACCACACCACGCAGGACAACCGCAGACACACGTCCAGGAACAGCGTCTGGCACATG
CTCTCCAGCGCGCTGGCGTCCATGCAGGGCCTCTCGGGCGATCTGGGCGGCCGGGTCGACTCGCACAGGACCGTCGGCGT
CTGGTTCGACCTGTTCGGCAACAGCCTGGTTCTGTTTGCCCTCCGCGGCCTCTTTGCATGGTCACTGACCATCCTCATCG
TCTCGCCCCTGGTTCTGGCTCTCGTCTTTTACGTGCTCTACAGAGCTGACAAGGACTATCTGTTTAGGGCGTCCGTCTCG
GTCGGACTGATGGAAGAGGCTGCCGAGAAGGTGCCTCTTGATGGGTGGAAGGGCTTTTCTCGCTTCCCTCTTGCTCTCGT
TGTGGCTGAGGCATTCGTCCTTGGCGCCGCTCTCCTCATCAAGAAGGTCCAGCCCTTTATCATCTATAGCAGCCTATATG
CAGTGTGAGTCTCCCCACTTCTTCACCTTCCCGTGTCTTATAAATGTTCTGACATGTTGCGGTGACAGGCTGGCCCTGAT
GACCTCGCTTTTTTACTGCGTCTTCTGGTTTGTCATGCGAGGTGCCGACGCTTCACGGCCGTCGGCGTTTCATCGGACGT
ATTCTCTTATTTGGCTTTACGTTCTCACATGGCCTCTTCTGGTTTATACCGCCGTCGTGGAGGACCAGAAAAAAATAGCG
TCGGGTTATATTGTCGCATTCTGGGCCTCGAGTGTCTTTGTCGCTACCGTCGTCTCCTTGCTGGAGAACCTGAGTCTCCA
GAAGAAAGGAGCTTATGCGGAAGGAATTGTTGGCGTGGCAGACGCAGATATTTCAGGCTCAAACCCTGCCGAAGACGTCG
GTTTGATTGCCCCGGGTCCGGAAGAAGCTGAAGATGGGTCGCCCGTCCACGAAACAACGGATGACGATGACGAGATCCCT
ACAGAAGCGAGTCCTCTCATCGGTGGCAATGCCAGAAACGGCCGTCCGACAACGTTTGCCACGAATTACCGACGATCTGT
CACGGCCATATTGAATGCAAGACGTCATCATGCCGATGGAGAACGAAAGCCGCAGCCCTTTCCCTCAGAACAAGCATGGT
CCGGTCGTCTTCCAACCTGGACTTGGCTTGTTCAGTTCCTGATCATTGGGCCGTTCACAATAATCATCACAGCGCAACAG
GGTCTCGCCATTGCCTTGTCGGTGCAGCAGACAGGGACGGATGGCTCCAATTTGCTGACGCCGTATCTTCTCATCGCTTT
CTTCACCACGTTTGTCTTCCTACCCATCACACCCTTCATCCATCGCGTCACTCGCCATATTCCGATATTCTTTGCCGTCA
TTTTTGTGGGCACGCTCGTATACTGCTTGTCTTCATTCCCATTTTCTCCTGCCAGCCCCTACAAAGTTTTCATCCGACAG
ACATTTTCGGCAGATACCGGGACAACATCCATCATCCTTACCGGTCACGAAGCTTATCTCCTAAAAATCAAGGCGGACCT
TCCCTTCGCTGTGGGAAAGCCGTGGACGTGTTCGCCTTCTCGGGGACGGCAGACCGGCCTGGTTGACTGTGCCTTGGATG
GCACTGGGCTCGAGCCGCACCTTGATGGAACGGAAACGCCCTTCTCGGATAACTATGCAAGACTCGTGACAATCAATGCC
ACGCGGTCGGAGTTGAAGAACAAAGCAACGATTGAGATCAACGCGGTAAACAGCAAGTCCTGTGCTTTGCACTTTGAAAA
GCCATTCAAGCAGGTTTCTGTGCGTGATAGTGCAAACCTCGACACGCGCTTTCCCTGGGCACCCGGTGCCGAAGTATGGC
CAATTACAGACGTCACGCTTTGGAGGAGAGATTGGGAGACGCCGTGGCTTGTGGACGTTGAGCTGGGCGACGACGACGCC
GAGACAGTGGCATCAACTGTTTTCGGCTCTGTGGTATGCAGATGGGCTGACGTCAACACTCCTGGCACAGTCCCTGCGGT
TGATGAGGCGTGGAAGTTTGCACCAAAGTGGTCAGTCGTGTCGATCAAGTCTAATCCGCCTCTCGTGGAGGGAACCAAAG
GTTTCTCGGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62