GenePrediction:GLEAN_3992 Details

Name: GLEAN_3992
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2122525..2123058 (+ strand)
Length: 534
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2122525..2122618 (+ strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_113:2122673..2123058 (+ strand)
Length: 386
>GLEAN_3992 class=GenePrediction position=GCSC_113:2122525..2123058 (+ strand)
ATGTCGACCGACGCGGGCGCCCGTGCCTTTTTTGCGCACCCCTACTTTGCCGTCGTTGGCGCCAGCAACAACACGGCCAA
GTTTGGACACAAGAGTGAGTGAAAGGTGCAGATGCAAAACGTATCAACGATCTTCTCATCGCACCCAGTCTTTGCCTGGT
ACGCCGCCCGCGGCCTGCCGGCCACGCCCATCAATCCGACCACGGCCAACATCGTCGTCGCCGGTCGCGACTATCCGGTG
CTGTCCGATCTCGCTGCCCTGCCGCGGCCGCACGAGACGGCCGTGTCAGTGATCACGCCACCGGCCGTCACGCTCGAGCT
CTTGCGCGAAGCCCGCCGTCTCGGCATCCCCGCCGTCTGGCTGCAGCCCGGCACCTTTGATGACGCCGTCCTGGCGCTGG
CCAGGTCTGCGGATGACGCCGACGACAGCACTGCCCTGCAGACCGTCGTCGCCGGCGAGGGCGGCCGCGGCAGCGAGGGC
TGGTGTGTGCTCGTCGATGGCGACCAGGCACTGCGGGCCAACGGGAAGTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62