GenePrediction:GLEAN_3994 Details

Name: GLEAN_3994
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2138344..2139793 (+ strand)
Length: 1450
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2138344..2138409 (+ strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_113:2138484..2139339 (+ strand)
Length: 856
Type: CDS
Source: GLEAN
Position: GCSC_113:2139411..2139793 (+ strand)
Length: 383
>GLEAN_3994 class=GenePrediction position=GCSC_113:2138344..2139793 (+ strand)
ATGTCTGCCTCAAAGGATATCGCGACGGCAGATGCATCTGCACCGCTGGCACTAGATGCGGCACAGGTGAGGCAAAGTTG
CACAGAGTTGTGGCTGATAATACGACGATGTAGCTGACCAAGGGAAACGGTCCAAAACAGGTGCTGACGGCGTCCAAAGC
TCTGCTGAGCCACATCAAGGAATCTGCCAAGGCTCAGAAGGAGAAGTCGGGCAAGAAGAACCTGCTGGACGAGAGCGATG
GAGAGGGAGAGCAGGGAATGGCCGGCAGCACGGCGGAGACGCCGATCTGGCTGACGCTCACAACCAAGCAGCACGTCAAC
GACTCACGGCGGCTGCAGCCCAGCAAGTTGGTTGTGCCGTACCCTCTGAACACCGATGAGGAGTCGACGATCTGCATTAT
CACGGCGGACCCGCAGCGGGCGTACAAGAACATTGTCGCATCGGACGAGTTCCCGGCCGAGTTGCGCAAGCGAATTAGCC
GCGTGATTGACCTGTCGCACCTGCAGAAGAAGTTCAAGGCCTACGAGGCGCAGAGGAAGCTCTTTGCGGAGCACGACGTA
TTTGTGGCCGACGAGCGCATCGTCAACCGGCTGCCCAGCGTCCTAGGTAAGACGTTCTATAAGAGCACGGCGAAGCGACC
GATCCCGGTAGTGCTGCAAAAGGCGCGGGCCAAAGGTGCCGACGGCAAGCGGGCCAAGGCACCCAAGAAGAAGGCGTCCG
GCGGCAAGACGGCGGCGGGCACGGACGAGAGAGCCGTGGCAGTGGAGGAGGCGACGTCGACGGCACGCTCGGCCGCGCAG
ATCGCCACGGAGATCCAGCGGGCTATCGGTTCCGTCCTCATCAGCCTGTCGCCGTCGACCAACACGGCGGTGCGGGTGGG
CAGCGCGGGCTGGCCGGCAGCTCACCTGGCAGCCAACGTGGAGGCAGTCGTGGAGGCGCTGGTGAGCAAGCACGTGCCCA
AGGGATGGAGCAACATCAAGGCGCTCTTCATCAAGGGTCCGCGGACGATGGCGTTGCCGATCTGGCAGACGGACGTGCTC
TGGGTCAGCGGTGCGGATGTGCTCCAGGACGGGTCGGAGGAGGCCAAGGCGATCGAGGCCAAGAAGACAACCAAAGAAAG
GCGGCCGCGGCCGCCAGCCGGGAGAAGGCCAACGTGGGCAAGAAGCGGAAGGCAGTGACCGACGACGACAAGGACGACGA
AAAGAAGCACGAGGCCGGCACCTTTGGCGCTGGCGTCGCCGAGGAGCAGGACAAGGCCGAGGCTGAGGACGTCCAGACGA
AGAAGAAGGGCAAGAAGGCCGTCAAGGGTGCTGCCGCCAAGGAGGACCGACCGGCCAAGAAGGCCAAGCTCCCTGAGAGC
AACGACAGCGGCCTAGACAAGGTTATTGCAGAGCACAAGGCAAAATTGAAGAAGCAGAAGAGCGCGGCAAAGAAGGCGCT
GGACATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62