GenePrediction:GLEAN_3997 Details

Name: GLEAN_3997
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2151885..2153478 (+ strand)
Length: 1594
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2151885..2151887 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_113:2151959..2152261 (+ strand)
Length: 303
Type: CDS
Source: GLEAN
Position: GCSC_113:2152322..2152387 (+ strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_113:2152454..2152864 (+ strand)
Length: 411
Type: CDS
Source: GLEAN
Position: GCSC_113:2152936..2153478 (+ strand)
Length: 543
>GLEAN_3997 class=GenePrediction position=GCSC_113:2151885..2153478 (+ strand)
ATGGTAAGTGGAAATTACACCAGATGGAAGGACCTGGAGCCTAGAGACCTATATTGAGGCTAACAGTGTGGCAGAAAGTC
AAGGTCTTGAATCGAGCGCCTGCGGCATCGCAGCACCAACAGCGGAACCATGACCCAGCCCTGCACCCGTTCGAGCAGGC
GCGAGAGTACACGCGAGCTCTGACGGCGGCCAAGTTGGACCGCATGTTTGCGGCACCGTTCATAGCGCAGTTGGGAGCCG
GCCACCAGGACGGCGTGTACTGCCTGGCCAAGGACGTGGAGACGACAGACCGACTCGCCTCAGCAAGTGCAGACGGTATT
GTCAAGGTCTGGGACCTGTCAACCCGGGCCGAGACGCAGCGGGCAAAAGCACACGAGGTACTTTGCACCTTTCATTCTTG
TCATTGTGGCGCTTACATGCGTGCAGTTTGCTAATAGGCGCGGCAGGGAATGGTCAAGGGCATCTCTTGGATCAAGAATC
AGAGCGGACGGTACCTCGTTTCCGTAAGTTGCTCCTCTCCCATGTGCACACACAGCTCTTGCTTACCAGATCTCCGTCAT
GCTCTATAGTGCGGTACGGACCGGAACATTTCTGTGATCGACACAGCAACGGGCGCTGTGACGTCGGGTCTCGGCGACTG
CGCATTCACGTCGGTTTCGAGCCACCGGACCACACCGACGGCCGTAGTGTCTGGGTCATCGCGGATATTCGTATACGATG
TGTCGCGGCCAACACCGACGGTGACGGAGACGCTGCAGTGGCCCAAGTCGGTCGACACGATCACGGCCATCCGGCTGAAC
CAGGTGGAGACCAGCATACTGGGAACCTGCGGCAGCGACCGCAGCCTGGTTTTCTTCGACCTGCGGACATCAATGCCGGT
GCACAAGACGGTGCTGAACTTTGCGTGCAACGATCTGGCGTGGAACCCGCAGGAGGCCATGAACTTTGCCGTGGGCAGCG
AGGACTACAACATTTACCACGTGCGTTGCTGTTTTTTTTTCTTATTGTCTTTTCTTTTTTCCGTTGCATCCTGCTGACCT
GCTGCTCCCAGTTTGACATGCGCAACATGCAGCGCTCGCGCAACATCCAAAAGGGCCACACGGGCGCGGTGATGTCTCTG
GACTTCAACCCGACGGGCACGGAGCTCGTCAGCGGCTCCTGGGACCGCACGATCCGGCTGTTCAAGACGGACCAGGGCAC
AAGCCGCGACATCTACCACACGAAGCGGCAAGGCCGGGTGCAGGCAGTGGCTTGGTCGCCAGACTCCAACTACATCCTGA
CGGGCTCGGACGAGGGCAACGTGCGGCTCTGGCGGGCCAACGCGTCGCAGCGTCTGGGCATCAAGTCGGCGGCAGAGAAG
ACGAAGCTCGAGTACGACGCGACGCTCAAGGAGCGGTACCAGCACATGCCGGAGGTGCGGCGGATCCTGCGGCATCGCCA
TCTGCCCAAGGTGGTCAAGAAGGCACAGGACATCAACCGGGAGATGCTACAGTCGATCAAGCGCAAGGACGAGAACCGGC
GGAAGCACAGCAAGGCCAAGGATGCCAAGCGGGCGTCGGCGCGCGACCAAATGATCCTGGCCAATGTCAAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62