GenePrediction:GLEAN_3999 Details

Name: GLEAN_3999
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2165086..2166665 (+ strand)
Length: 1580
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2165086..2165133 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_113:2165270..2166175 (+ strand)
Length: 906
Type: CDS
Source: GLEAN
Position: GCSC_113:2166239..2166527 (+ strand)
Length: 289
Type: CDS
Source: GLEAN
Position: GCSC_113:2166601..2166665 (+ strand)
Length: 65
>GLEAN_3999 class=GenePrediction position=GCSC_113:2165086..2166665 (+ strand)
ATGGCCGGTAACGCTCGATATGTGCGATACATTGTGATCGCGTTCTTTGTACGTCACTGGTTCTACGCGTTGCTGGCCCT
TACGGGTTCGGCCACGTTGAGCTCAGATCCGCAGCTGGCCAGCCTTCCAGCTCCCAGTGCATAGCACGATATACTCGGAC
ACATCTAACCGATCGTCCTTCTAGATTGTTGCCATATTCTACATCGTTTCCAACTCCTCCGAGACGGTTGCCTTGCGGGC
ACCAGAAATGCTTGGCGGCAAGCCTGTCTCCTCAAGCACCGGTAGTTCTGATACAAATACGAAGACAGACGGGAGTGCTG
CGCCAGCTGCTCCCGAGACTACCGGCACGGCCCCAGCTAGCGACAAGACGTCGTCTGGCAAGACGGCCAGCGGCAGCTCT
GCCGAGGCGCCGATGGCCATGACGCCAAACGACTCTGGATTTTACGAATTGAACCAGATTGCACCGGGTCCGCGTATGAA
TGCCACGTTCGTCACGCTTGCGCGCAACAACGACGTCTGGGAGGTGGCTCGGTCCATCCGGCAGGTGGAGGACCGGTTCA
ACCGGAGGTTCAACTACGACTGGGTGTTCCTCAACGATAAGCCCTTTGACGACACTTTCAAGGCTGTCACCACTTCTCTC
ATTTCTGGCAAGACCCACTACGGTGTGATTCCTAAGGAGCACTGGTCTTTCCCGGACCACATCGACCAGGACAAGGCACA
GAAAGTCCGCGAAGAGATGGGCCGCCAGAAGATCATCTATGGTGACTCGGTCAGCTACCGCCACATGTGTCGTTTTGAGT
CAGGCTTCTTCTTCCAGCAGGAGCTTATGCTTAACTACGACTACTACTGGCGTGTTGAGCCCAGCGTTGAGTACTTCTGC
GACATCCACTACGACCCCTTCCGCTACATGCACGAGAACAAGAAGAAGTACTCCTTCGTCCTGAGTCTATACGAGTATGC
CGAGACGATCCCAACCCTTTGGGAAAGCACGAAGAAATTCATGCAGGCGCACCCGGAGCATATCGTTGAGGGCAACTCGA
TGGAGTTCCTCAGCGATGACAACGGCGAGACGTACAACAAATGCCACTTTGTAAGTCCTGATTTTGTTACTTGAGATGAC
GCTTTGTTATGAACAGAGGCTAATACACTTCAGTGGTCCAACTTCGAGGTCGGTAACCTGAACTGGCTTCGCTCCAAGGC
ATACATGGACTTCTTCGAGTCGCTTGACAAGGATGGTGGTTTCTTCTATGAACGATGGGGCGATGCACCCGTGCACTCCA
TTGCTGCCGCCCTAATGCTCAAGAAAGAAGAGCTCCACTTCTTTGACGATATTGCGTACTATCACGTCCCTTTCACCCAC
TGCCCGACTAGTGAAAAGACGCGCCAAGATCTTCACTGTCACTGCGACCCCAGCAAAAACTTTGACTGGAAGGGGTTCTC
TTGTATGTTGGCATATCTACCAGATTCCATGGCCCTTACAATTTTACGATGAGCCAGTCTACTAACTTGACACAGGCACG
TCGAGATTCTTCGAGCTGAACCACATGCTAAAGCCGGACGGCTGGGAGAAGCAGACCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62