GenePrediction:GLEAN_399 Details

Name: GLEAN_399
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1546280..1549118 (+ strand)
Length: 2839
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1546280..1546393 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_167:1546544..1546607 (+ strand)
Length: 64
Type: CDS
Source: GLEAN
Position: GCSC_167:1546806..1546984 (+ strand)
Length: 179
Type: CDS
Source: GLEAN
Position: GCSC_167:1547041..1547846 (+ strand)
Length: 806
Type: CDS
Source: GLEAN
Position: GCSC_167:1547927..1549118 (+ strand)
Length: 1192
>GLEAN_399 class=GenePrediction position=GCSC_167:1546280..1549118 (+ strand)
ATGTCTGCACCCAACCAGCACGGCGGCCAGCATGGCTCGGGGGTTGGGCCGTCGTCGGCTGCCACGGCAACTTCGCAAGC
AACGTCGAATTCTCCTTCCGATCTGAACAAAATTGTACGTCATTGCGCTCGCGCCTGGCATTGCAAAAGGGCCATCCACC
TACACCAATATTTGCCTCGCGTCCTTGCTATTTTCCTGCACATGTACTTTTACACATTCGTGGTTTCAACCCCTCTACTA
CCCAACTGATGTCCACCCCGCAAGGCTCACGCCGTGCAGAGCACGGTGGGCGGCAAGGACAAGGCGCCGCGGCCAGAAAA
GTGCATACGTATGCGGAAGGGCGCACGATAGTACGTTTCTGATGGCACAGGACGCAGGCATCTGAAGTTTTTACCATGTT
CAGCCCTGTCCTGTCTATGAAAGCTCATCCGTACTCACTTTCATGCTTGCTACTCTCCATGCTCCCTCAGCTCTGACTAG
GCCCTACTTTATGCGGATACTGACCATCTTGTGCTGCAGGTCACAGACTATTTGCTGAAGAAAGGATTCACGAAAACCGA
GGCAACATTCCGCAAGGAGTCTGCAGTTGTCAATGCTGACGGCCGGCCCGTTCGAAGGAGAGTCGACGACATGGGTCCCG
AGCGCTACGGAAAAGCTTTTAAGCTGCTGAAGAACTGGATTGAGAATGGGCTGGATCTGTACAAGGTACGTCGACCGTCA
GCAGCCAGACTACGGCCACGCGTAGACTGACGTCTTCGCAGTTTGAGCTTTGGAAGCTTTTGTGGCCTGTCTTTGTATAC
TCGTTTCTGGACTTGGTAGAGCAGAATTTCGTGCCAGAGTCCAAGGCGTTCCTCCTAGAGCGGAAGCCAGACTTCGAGGG
CAATCACGCCGACGACCTCCGCACATTTGGCACAATCCAGCTGCCCGTCCACATCACGGAAAACCCGACGACCAGAACCT
ACCGGCAGAACAGATACCGAATTCCACTGAACCAGCATGTCAGCGGCCAGCTCTTCAGCTTCTTGGAGCGCCAGGAAGAG
GCTGGTGGCAACGTGATCACACATATCCTACAGGCCCACTGCCAATTGGATTCTACTGCCCGCGGCCCCATCGAGCCATA
CAGCTTTGAGGCCATTGCACGTCGTGCTCAGAACATGGACCTGGACGAGGCAGACGCTCAGGAGGGCATTTCGGGTGTGT
TTACGGGCGTCAGCAACCGGGATGTTCTCAGCGCGCATACGGCACTGAGACTGGGGCCGCTGCCGATGGAGTCCGACCTG
CGGGAAGACGTTCGTGCGGAGCTCGAAGAACAAGACCAGCGGCAGCCGCCTGCTGTCGGTGTTCCGTCTCTGGTCTCGGA
GTTTGACGCAAAGATCAAGCAGGAAGAGGGCGTGGACGGGCCTTCTCGTACCGACCTCCCGCTACCGCCATCGCGGGCAA
GAGATGTTGTGATGGAGATGCAGAAGATTCGCGAAAACCGGGACCGTTTTCGCATTGATGACCACACTGGCGGTGTCGGG
GTGCCAGTTTCGGTGTGCATGTTCACATTTCACAACACCAGTGGCAGGTAAGCCGATCCTTTTCTCCTTTATCGTCGTGT
CGCAGGTCAAGCCACAGAATGCTGACGTTTATTGGCAACTCGGACAGCGTCTCATCCATGGCCTTCTCCAAGGACCACCG
GCTTGTTGCTTATGGCACGATGGACTCGTACATCCGGGTCTGGAGCGTCGATGGCAAGGCGCTGAAGAGCAAGCTGATCG
GAGATGAGGACAAGACAAACAACAGAAAGCTAGTGGGCCATTCCGGGCCGGTCTACGGCCTCTCCTTCTCCGACGCCGTG
GCTGGGTTCAAGCACAATCCTTTTGACGAGAGGCAAGCCCCGCTAGAGACAGACTCGAAGCTGCTGCTGTCTAGTTCTGC
TGACGGTACGGTGCGACTCTGGAGCCTGGATGTGTGGTCTTGTCTCTGCGTATACAAGTCTCACACCGGGCCTGTGTTCC
GGGTGCTTTGGGGGCCACACGGTCATTATTTCCTCACGGCTGGCTGGGACAAGACGGCGCGAATCTTTACGCAGGACCAC
GCCTCTGCACAGCGGCTACTGGTAGGACACAACACGAGCATCTCGGCCATCGCGTGGCATTCAAACGGGACGTATGTTTT
TTCTGCATCTGACGAGACAGACAAGACGATTCGCATGTGGTCTGTAATCAAGGGCGATTGCGTGCGCGTCTTCACAGGAC
ACGCAGATTACATCAGTGCGCTAGAGTGTGCACCAAACGGCAGAATCCTAGCAAGTGCCGATACAGGGGGCAACATTTTC
ATATGGGATATTGAGAAGGGCACTCGTATCAAGCGATGCCGCGGTCACGCAAAGGGCGGCATCCCGTCGCTGAGCTTCAG
TGCCGAATCCACGGCTCTCGTATCAGGTGGGCTAGATGGCACTGTCCGTCTCTGGGATGTCAATCTGCGGAAGGACATCA
ACAAGGGACCCGCACTCCTCGGAGTGGGTGCATCGGCAACGACGGCAGCGGGAGCAGGAGCAGGAGCAGGAGCAGCGACT
GATGCAGCCGGCAACGCAGCCAGTGACTCTGTGACAGTCGGCGGTGTACACGACCGAAGCATCACGGTGGGAGGCCATTC
GGCACAGGCCAGCACGAGCACGGGCACGGGCACATCGACAGCAGGTGGAGGCGGCGGTACGGGCAAGAAGAAGGGGAGCA
AAGAAGTCATGATCACACCGGACCAGATCAGCGCATTTGCCACAAAGAAGACGCCGGTGCTGCGTGTCGAGTTCACGCGC
ATGAACCTGGTCGTTTGTGGCGGATGCTTCGACCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62