GenePrediction:GLEAN_4000 Details

Name: GLEAN_4000
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2168450..2169771 (+ strand)
Length: 1322
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2168450..2169279 (+ strand)
Length: 830
Type: CDS
Source: GLEAN
Position: GCSC_113:2169347..2169667 (+ strand)
Length: 321
Type: CDS
Source: GLEAN
Position: GCSC_113:2169726..2169771 (+ strand)
Length: 46
>GLEAN_4000 class=GenePrediction position=GCSC_113:2168450..2169771 (+ strand)
ATGACAACCCCACGGCGCACCGATGAAGTAGAGATGCCACCACTACCGATTACGTCCTTGACGGATATCGAGGCATCCAT
GCAGGAAGCGGTGTCCAAGTTTGCCAGCGAGATCGTGTTGCCGAAGGCCCGCGAAATGGATGAGGCCGAGGCCATGGATC
CGGAAATTGTGGAGCGGCTGTTTGAGCAGGGCCTCATGGGGATCGAGATTCCAGAGGAGTATGGTGGCTCAGGCATGAAT
TTCACATCTGCCATTGTGGCAATTGAGGAGTTGGCTCGCGCAGATCCCAGCGTCAGTGTTTTGGTGGACGTACACAACAC
CTTGGTCAACACCGTATTCATCAAATACGCCAGCCCAGCCCTCAAGAAGCGGATTCTGCCCAAGCTGGCCACCGAATCGG
TCGGCTCATTCTGTCTGTCGGAACCCGTATCGGGGTCTGACGCCTTCGCTCTGGCTACGCGGGCCACGGAGTCTGAGTCG
GGCTTCCGGATCTCTGGGTCCAAGATGTGGATCACTAACAGCATGGAGGCTGATGTATTTGTGGTCTTTGCCAACCTCGA
CCCGGCAAAGGGCTACCGTGGCATCACCGCCTTCCTAGTCGAGAAGGGCACCAAGGGCTTCTCGATTGCCAAGAAGGAAA
AGAAGTTGGGCATCCGTGCGAGCAGCACATGCGTCATCAACTTTGACGACGTCGATATTCCCAAAGAGAACCTGCTTGGA
GAGCGCGGTCACGGTTACAAATACGCCATTGGGCTGCTGAACGAGGGCCGCATCGGTATTGCCGCCCAGATGACCGGCCT
GGCCTTGGGTGCCTGGGAAAATGCTGTCAAGTGGGTGTCCTTTTTTGGTCTAATCCACTAGAATAATGGCCCCAGTAAAG
ACTGATCAAATGCATAGGTACTGCTGGAACGACCGGAAACAGTTTGGTCAGTTGATCGGCGAGTTCCAAGGCATGCAACA
CCAGTTTGCACAGTCTTATGTCGAGATTGCAGCTGCTCGAGCACTGGTCTATAACGCGTCACGAAAGAAGGAGGCTGGCG
AAGACTTTGTCAAGGATGCTGCCATGGCCAAGCTGTACGCGTCGCAAGTAGCTGGCCGCGTAAGTAGTCTGGCTGTGGAG
TGGATGGGTGGCATGGGCTTCGTCCGCGAGGGTCTCGCGGAGAAGTACTTCCGCGACAGCAAGATTGGCGCCATTTACGA
AGGCACCAGCAACATTCAGTAAGGCTTGCCTCATTCAACATCCTTGAGAAATACTGGTAGCTAACGTCAACCACAGACTA
AACACGATTGCCAAGTTGCTTCAGAAGGAGTATACCAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62