GenePrediction:GLEAN_4002 Details

Name: GLEAN_4002
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2178567..2181847 (+ strand)
Length: 3281
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2178567..2178822 (+ strand)
Length: 256
Type: CDS
Source: GLEAN
Position: GCSC_113:2178877..2180573 (+ strand)
Length: 1697
Type: CDS
Source: GLEAN
Position: GCSC_113:2180640..2180715 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_113:2180784..2181847 (+ strand)
Length: 1064
>GLEAN_4002 class=GenePrediction position=GCSC_113:2178567..2181847 (+ strand)
ATGGGTGTCGATGCCGACGAGCTCATCTTCCGCCCGTTTCGGGAGGTAGCGGAACGTGGCAACGAGGCCGTAGCCAACAT
CGGCGAGGCAGGCGACGATCTCAATGGAGACGCAGCCGGCGCCAACAGCCTCCTCGCCAAGGCTGGACGGGCTCTGGTAA
AAGAGGGCGAGCGGGCAATGAAACGGCTGCAGCCTGTCTGGGACGGCCAGGCGGAAAAGTATGGCAACGCCTTCAAGGAA
GCGATGTTGCAACAGGGTGGGTATTTTTAGTCTCCTTCACACGTTCTGGCCCACGTGCTGATATGCCCAGACGACATCGA
GAAGAAGAGGCTGCAGCTGGAGGACCTGTTGTACGACTTTGAAGACTACATCGAGCCCGACACGTTTGATGGCGACCGGT
TTGCTGCCGTGCAGGCAGCCACGCGCTCGCTGGCTTTAGACGTCATCAACCACGCCAAGCGCATCAAGCTGGAGTCGCCC
CGACGAGAGAGCACGGCCTCGCAGCTGGCCGCTGCAGCTGCGGCCACCATTGCGTCGACCCGGGGAATGACGTTTCCACC
ACTGCCACCGTTACCCCCGGTGCCATCAATGCCACCGATGCCGCGATCCTCGCTAACGACGACGATGCATCCCCGCGCGC
TCACGTCTATTCCCATTTTTACACCCACATCACCTGTAGCCGACTTGGCAGCCGCCCTGGGCGACGAGGACACCATCCCT
GACTGCGATGCGCCCCATATCAACTACAGTGGCTCCAGCAGGCTCGAGAGCCTGCTGGATCTTCGGCGCCGAAACACGCG
AGGCTCCACGACGACATCCAGCTCTCGCGGCTTCGAAGACCGCTTCGTCGGCGACGATGCCTTTAGCAGTAACGACGCAG
TGCGCATCACCCCAAGCAGGCCTACAATCATCGATGCTACATCTCACCCATCGCCGCCTCAGCCTCTATCCTCTACCACG
TCACCGCTGCTATCTTCGGCTGCCATCCCGCGCACCTCCGCTTGGGTGCGCAACCATCAGGCCTCCATCACGGGACGCGC
GCGCTCCAGCGTGCGAGGCAAGACGTCGCGCGAGACTATGGCTACGGAATACAGCAACAACGAGAGTCCGTTGATGCTGT
CGCGATTCAGCTCGCTGACTGTTTCCGGGGCCGCCTCTGTCTTTGACCACGGCCTGGGAAGCCCGGGCGGGATGACCGAC
TCGCGCACCTCCTACATGCCCTCAACTGCCAACAGCTACACGTCTGGGTCTCCCATCATGGTCTCGCCAAGCTGCGTACC
GGCTCTGCCACCCGCGACCGATCCCCGCGATCCGCGCAACGCCCTACACATGACGTCTGTCACCCTCCCACCACCCTTCG
TCTCCCCTAGCCTGCCTCCTATCCGGTCGGTCCCGTCGGCCGAGTCTGTCCAGTCAGTTGTGTCGTCGCCCGCGCTCTCA
GGCCGAGCTGAGCGGAACATCTTGTCTTCCACCAGTGTGTTGCCATCTCCAGCGCTGTCCCCTCTGATGCCTTCCCAGAG
CATACAGGACTTCATTCGGTTCGACCCATCACCCTTGATGCCGCCAATCAGCCTTCCAATGTCACACCAGCTGGCGCCAC
AGCAGGAAGAGGTGCGGGATGGAGAATACTGGACTGGCTCATTTCATCGTCCGTACCAGCAGCCGGATCAGACGCCGGGT
CAGTTATTGCAGTCGTCGGCCATGAGCGTACCGGCACCGCTCAGTCTGCTGCCGGCTACACTGCCGTCGGCCCCCTCAGA
CAGCCACTATGACAACGGCTTGATGTTGGCGGAAGAGAGCTCGAACGCCGGGTTGCATGGCGGATCGGAGGCTGACACAG
GAACGAGCCTGGATTTTCCGATAACGCGCGGGTTTGTGCGTGAACCAGATTGCAGCATCGGGCCCAGTAGTAGCTTCGTC
AAGCTGGGCGGATTTTGCCAGGGCGCCGAGTCGTTCCGGCTGGGCGGACACTGGCAGGGAATCAAGCAGCAGGGTGGCTA
TGTTGCAGTACGCGATTCGTCTTGTTTCGATGCCTGTGAGTGTGGCTTGACTGACATGCAATAGAACAAGCAGACAACCA
TCGGCCGCTGCGTCGACTGTGGCTATGCCCACAACTACGAGGAGGTTCGGCTCGATATGGAGAAGAAGCGTGTGTATCTA
CCGTTTTTATGCCCTCCTGACTGTCTCTGCTGCAGCCGACGCTGACCTGACATTCAGCCGAGGCCACATTCACCAAGGCG
GGAGGGGTGCGTTTTCGTCTGCGCCTGCTCTACAAGTCACACCTCAGCAACCATCTGGCGTCGCAGCGCCAGGCTGAGAG
CAACTATGCATGCGTGTTTTGCGTACAGGCTGGCGCTACGGTGCGAGAGGGCGATGCCACCGTCTTCACGACGCCCGACC
ATCTGTTACTGCACCTGGCCCGCCACCCACAGCCTTTGCCAGCCGTGCCTGGCATCAGTGTTGTGTATGGCGAGATGGCT
GAGCCGGATTCGGAGCTGGCCAACGATTTCGACCTGCACCTGGTGCGGTCACCCATGCCTATACCAGTACCCCCGACGGT
CGGTCAAGCAGCTGTGGCTACGGCAGTGTGCGACCACATGCAGCGGTACGGGTCGAAGAAGCTGATGCGGCCGCCTAGAT
ATACCGAGGACATGCTGCACTTTCTGGCAGGCGCACGCATCGTCGGGCTCATGTTTCCAGAGGCGTGGGAAGGCAAGTGG
TGTTTGGGCTGGCACGACGGCTTCGTGGGCGCCTTTGCAGCCAAGGCCGTGCAGATTGAGCCGCCACGGAAGAGCGAGAT
CCCGATGGAGAGCAGTAGCGGGATGAAGGTGACGGCGAGGTGGAAGTGGAAGCCCAAGGCAGCACCAGGCAGTACAAGAG
GTGGACACGAAGGGAAAGGCGGCAAGAGCGGGAGGCGAGGGAACGACAGCGATGACGAGGGCGTGAACGAAGATGACGAT
GGCGCCAATAGTGACGCTGCCTCTGTCTGGCTCCACTTTGACAAGGGCGAGACGATCTTTAACGTCAAGTGCCTGTACGC
GGACTACTGGTGTTGGGCCGGCACCGACAGCAAGGGCCGCTACGGTGTTTTTCCACAGTCACATATCCTAACGGAGACGC
TGCAGCAGGAGATGTTGGCGCCGCAGCCGACCAAAACTGGCTGGTCGGCCAAGAGCTTCTTCAGCAAGGGGGGGGCTATC
GGCAGCACGCGACGGCCCGTGAGCAGCAGCGCTTCATCGTCACTAACCAGCAACAGCATGGGCCAGACTCGGCGGTCTTG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62