GenePrediction:GLEAN_4003 Details

Name: GLEAN_4003
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2183218..2184990 (+ strand)
Length: 1773
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2183218..2183437 (+ strand)
Length: 220
Type: CDS
Source: GLEAN
Position: GCSC_113:2183491..2183547 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_113:2183603..2183682 (+ strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_113:2183744..2184100 (+ strand)
Length: 357
Type: CDS
Source: GLEAN
Position: GCSC_113:2184301..2184990 (+ strand)
Length: 690
>GLEAN_4003 class=GenePrediction position=GCSC_113:2183218..2184990 (+ strand)
ATGATTTTCAAAGGCGGCCTGCCCGAGTGGCGTCCATACGGCAACTCGCTGCTCTCGGTGACGCCCGAGGAGATCAGCAA
ATTCGACCTGTCGGACAAGTCGTCGCTGACGGGCGTCGTGATTGCGGTGCCGGCAACCTGCATCTCGCTCATCACCGTGA
TCGTGTCGCTGCGGCTGCTGCTGCGACGACACACCATCGGCCGTCTCTTGGTGGACGACTGTGAGTGAGCCATGAGAAAA
GACAGCGGCAGCTCGACGTGCTGACACTCACAGACCTGATCGTGCTCGCGTCCGTCTTCACGATCGTCGTGTGTTCCTCC
GTGCTTGCCGGTAAGACAGGCCGATTCATTGTGCAAGGGACCACCCATGCTGACAGCCGTTGCAGCCTCCCAGTATGGTC
TCGGAAAGCACATCTGGAACCTGGACTTTGTCACCATCATCCCGCACCTGAAGAGATGCATCCGGGTATGTACAGATGGA
ATTCGTTCGGTCGGACAGCCGACAGCGACAGCTGACACTCTTCCAGTTCATGTTCGTGGCCAACGTCTTTTACGCCCTGG
CCATCTGCTTCACCAAACTCTCAATCGTGTCGTCGTACGTCTACATCTTTGATCCGCACGGCCGGCTCAAGGTGCTCATG
TACGGGACGGCAACCGTGAGCACCGGCCTCGGCATCGCAGCGCTGCCGGCCACCATCTTCGAATGCCTACCCGTGCACGC
GGCCTGGGACGTGACCTATGTCGGCGCCAAATGCTACACCTTTGTCGACTTTCTGTACGCCAGCACGGCCATCAGCGTGG
TCACCGACATCATGCTCTGCGTCATACCGATCCCGCTCCTCTGGCGGCTACAGCTGCCATTGCGCCAGAAGCTGCTCATC
TCGGTGCTCTTTTTTCTGGGCGGATTGTAGGTTTCTTTTTTTTTTTTTTTTTTTTTCCTTTCCCCTTTCCCCTTTTCCCT
TTTCCCTTTTCCTTCTTTTGTTTCAATCTTTTTTCCTCTTCCCTCCTCCTTTATGCACCCGCTGACGTTACAGCGCCTGT
GTCGCTGCCATCGTCCGGTTGGCCTACCTGCATCTGCTGTCAGACCCGGTCGACGTCACACGTGAGATGCCCTCTCTTCA
TCCGCACACCACACTTCACACCTGCTGACCCAACAGACGACCTCGTCTCGTCCGTCATGTGGACCATTGCCGAGTGCACC
ATCGGCATCGTCTGCGTGTCGCTGCCGCCGCTACGCTTGCTCATCGTCCGTGTCATGCCGGACCTGTTCCACCTCCACAG
CAGCCAGTCCAGCCGGCCGACCGAGGAACAGTTGCCGCGAGACCAATCATTGAGCTCGAGCCGGATGCGCAGACTGAAAT
TCAGCCGGCTCGGCCGGTCCGATCGGTCCGACCGATCCGCCCACAGACAGTGGTCGCAGAAGACGGTCGACGTGGTCATG
CTGTCGTCGGTGTCGTCGCAGCCGTCACAGCTGCCCCAGCCGTCGTGGATGCCACGGACGCCACCCAATAATGCCTTTAT
CCTGCCGCGCCACCAGAGCCTCGGCATTGGGGATATAGGCATGTCCGTGATGATCAGCGCCGGCCCCGACACCTATCACG
ACCGAGGCTGGGACCGAGACCGCGCCCGATCCACGACCTTGGCTACTACCGCCACCGACAGCACGCTCGTCGGCTCTCCC
AAGGTCTCGTCCATGCTGACAACGGCTGACGGAAAGGCACGACAGTCGCTCGGCTCCCTGCACGACTCAGAGGTCCCGTT
GAGCTTGGGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62