GenePrediction:GLEAN_4004 Details

Name: GLEAN_4004
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2185564..2188505 (+ strand)
Length: 2942
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2185564..2186283 (+ strand)
Length: 720
Type: CDS
Source: GLEAN
Position: GCSC_113:2186351..2186391 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_113:2186454..2186849 (+ strand)
Length: 396
Type: CDS
Source: GLEAN
Position: GCSC_113:2186927..2187156 (+ strand)
Length: 230
Type: CDS
Source: GLEAN
Position: GCSC_113:2187215..2187276 (+ strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_113:2187330..2187451 (+ strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_113:2187512..2188505 (+ strand)
Length: 994
>GLEAN_4004 class=GenePrediction position=GCSC_113:2185564..2188505 (+ strand)
ATGGACCAGAGGAAGAGTAGCAGCAGCAGTAGCCGTGAAAGAGGCTGGATGACGTCCTCGACCTGCCTTTTGTGGATTCT
GCTGGCGGTCTGCTGGACGGGCGTGACCGCGGATGTGCAGCAGCAGCAGCAGCGAGTCGAGAGTCTGGGCAGTCCTGTCG
ATGGCTGGCTGGAAGTGCCAGATGGGCTGACGGCATCCGATCTTTCCGACCTCTTCTCGCCTTCCTTTTTGTCTTTGCCG
CTTTCACACCAGCTCCGTCCACGGAATGCTCCCGACGATGACGACGAAGACGACGATGGCGAGACGTTGCGGCCACGCCC
GCGCAGCGACCGTGCCCGCTGCTCCGACGCCTGCCAGATGGTCGTCGGGGCGGTCGCGTATGTCGATGTGGCGCCAGCGA
GCAGACGCGTGCAAAAAGCCTGCGGCAGCCGCCTTCTGCAGACGTCGCTGTACCTCTGTCTGCGCGTCTACTGCGCCGGC
TACCACGAGGCTGCTGGGATCGAACGGCTCAATCGGACCTGTGCCACGGTCGGCGACAGCAGCCGGCAGCCGGAGCAGAA
CGTGCTGCCACCATACCATGACCTCGTTTCCGGCTATTCGGACGAAGATGTCGCCCAGCTGCGGCGACTTCAGCCGTCTG
ACGTCGACTTTCCACCGGCCAACATCAGCGAGGCCGTCGTGCCCTCTGAAGCGCTGTACCGGAACGGATACGACACCTTG
GTGCGTCTGTTCTTTTTCTGTCCGGTGCCTTTTTGCTTTTTGCCTGCCTGACCCGTTGTCACTGCAGGATGACTGGCTCT
ATGTCCACAAACACCATCTCGCCTACAGGTATGTCCACTCGACTCCGTACCCATACATTGTGCTGACTAAGCAACCATCA
CCAACCACAGCACCATGATGCTCCTCTTCTGGATGGTTGTTGTTATCGTTGGCATCTCCTGCCGCATGGCCGCTGTCGTG
AAGAGAGCTGCCCGGCGGATAGTTGCTCGCAGTACCGACTACCAGCCGCTGGCCGGACGTGCTGCCGACGGTCTCGACGC
CGACGCTGATGCCGATGCCGACGAGGCAGCCCTGGCCAAGAGCTCACCTCTGGCGGTTGCTGGAAGACCGGGCATCTGGC
TGCGGCGCTATGTGACACTGCCGGCGGCCTTTGGCTACCGCTGCGCACAGGACTTTGGCTGGTACACGGTGCCGCCACGG
GTGCAGAGCCTGACGATTGCCGTCTTTGTGGCCATCAACGTGCTGTCGTGCGTTCAAGGCTATCAGACGTTTTCCGGAAA
CATGTAGTACGTCTCTGGCCCGTTTTTCGTTCGTCTCTGTATGGCCTTGTCCTCCGGGGCTGATCTTGTTCTTCGTCTCC
CAGTTATCCTCTCGTCCACGAACAGCTGCTCCGCTACGTCTCAGACCGCACCGGCATCGTCTCTTATGCCAACTTCCCGC
TCATCTGGCTCTTTGGCATGCGCAACAATGTCCTCCTCTGGCTGACGGGCTGGGACTTTGGCACATTCAACAACTTTCAC
CGTTGGGTTGCGCGGGTGGCCACGGTGCAGGCCATCATCCATTCGATCGGCTACACGCTGCTCATGTGTCGAAGTGAGTG
ACTTGCTGTCCTTGTCTTCGGCTGTCTTGCTGACTGCGGCCAAAACGGCAGATGATGGCCTTGCTGCTTTTGTTGAGTGG
TGGGCCATATTCTTCTGGTGGACCGGCGGCGTAGTGAGTTTTTGTCGTGTCCTTCTCGTCTCGTCTCGTCCCTTTCTAAC
CCTCAGGCCACCATCTCCATGTCGCTCCTCCTCGGCTTCTCGCTCTACTGGATGCGTCGTCATGTCTACGAAGCCTTTCT
GGTCCTGCACATTGTCTTGTCCATCCTCGTGCTTGCCGGCATGTTGGGGTACGTCGTTTCTTCCTTTGTCTCCTCCAGGG
TTCCTTCTTCTCTTCGCTGACCATCCAGCCATGTGTCCATCTTCCACGGCCGGTTCGACGGTCTCGTTTGGACCTGCACT
GCCGTCTGGCTGGCCGACCGCGTTCTCCGCAGTTTGCGCATCCTTGCCTTCCACCCGCGCTTCTGGCATGTCGTCCGGGC
CGCGGCCACGTACGACGCCCAGTCCAACTTGGTCCGGCTCGTGGTCCCGTACAGCACCAGCCTGTACCAGCCCCGGCCGG
GGACGTTTTATTATCTGCATGTGCTGGACGGCTGGCGCTTCTGGGAGAGCCATCCATTCACGGTAGCGTCGGTGGGAGGC
GAAGCCGAGCCGGACGCCAAGCCTGGCCCTTCTTCCTCCTTTTCCGCTCTCGACGACAGTTCTGCCACCATTCGGGTCGC
TGGACACACTCCCTACCCGTCTACCATGACCTTTCTCGTCCGTCCGTACGACGGCTTCACCGCCCGTCTGCGTGACAAGG
CCGCCACCGCATTCATTCCTGCTTCGCTGCCTGTCCTCGTCGATGGGCCCTACGGCCATGCGCCACCCCTGGCCACCTTT
GACGCCGTCCTGTTCGTCGTCGGTGGCAGCGGCGTCGTCGTGCCGCTTTCGCATCTCAGCGGTATCGGCAGGGCGTCGCG
GCTGCGTGCTGTCCACGTCGTCTGGGCCGCTCGCGAGGCCGCCATGACCGTCGACATCATCCGCACCGACTTTGCCGGTC
TGCTCGATGGCAACAGCACCGTTCGGCTAGACGTTCACATCACGTCGGCAGACAACAGCGGCAGTCTCCCCCTCCCAGAC
ATCCCAGATCTCCCCAGACAGGCCCGTCTGCTTGTCGGGCGGCCAGACGTCCGCGGCGAGGTCGAGTGCGCTGTTAAGAA
TATCGCGCCCGGCTGCCGGCTGGCTGTCGTCGCCTGTGGCCCTGCTCGCATGGCCGATGACGCTCGCCGCGCCGTCGTCG
ATCTGCTCGGATCACCGACCTGTGGCCATGTCGAGTACTTTGAAGAGAGTTTCCAGTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62