GenePrediction:GLEAN_4006 Details

Name: GLEAN_4006
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2196483..2198279 (+ strand)
Length: 1797
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2196483..2196790 (+ strand)
Length: 308
Type: CDS
Source: GLEAN
Position: GCSC_113:2196850..2197057 (+ strand)
Length: 208
Type: CDS
Source: GLEAN
Position: GCSC_113:2197126..2197845 (+ strand)
Length: 720
Type: CDS
Source: GLEAN
Position: GCSC_113:2198154..2198279 (+ strand)
Length: 126
>GLEAN_4006 class=GenePrediction position=GCSC_113:2196483..2198279 (+ strand)
ATGGGTCGCCGCGGTCATCGACATGGAGGCGGTGCCGGAATGGGTGGAGGAAGAGGCAGCGGGATGGGGATGGCAACACA
CATGGCGGCCGATATGCCTCTTCTACCACCACCGCCACCACCACCGATTGATGTGCATCCACCAGTAAAGGGCCCGTACC
CGGGAGTTGTCTCTGTAGCGTGCCAGTACACCCAGGAGCAGCAGCTGCGACGGATGCAACGCGACAAGGGCTGTGATCCA
TCTAGAGAAGACAGCTACCGTCTGCAAGGAGTCCAGCTGATCGATAATGTCCGGGAGTCGCTGCAGTTGTGGGTTCTCCT
GGTCTACCACGTTCCCCTGTCTTCATTAGGCTAACTGTTGCTCACAGACCTGTCAAGACGTTTACTACGGCCTGCACATA
TTACCACAAGTTCCGCCTCAGCTTCCGAGATGCTGAATACAACTTCCAGGATGCTGCCTTGTCGGCTCTGTTTGTGGCTT
GCAAGGTGGAGGACACTATAAAGAAATCTAAGGAGGTTCTGTGTGCGGCCTACAACCTGAAAAACGCAGACAAGCCGACT
GCGCCCGATGACAAGGTCAGTCTATACATATGCTTATGCTGCTTTCTTCTGACATGGTCTGACTTTTCTGCAACTCTTCC
TAGATCTTTGAGCGGCCCTCTACGATTATCGTTGGCCTTGATCGTCTCATCCTCCAAACTGTGGGCTTCGACTTTCGCGT
CCGCCACCCGCAGAAGCTGCTGATCAAGATGATTCGCCGGCTCATCCCGCCGGAAGATGCAAAGGAGTTTTTGGCTGTGG
CATACCCCATGTCCATCGACCTGTACAAGACGTTTGCGCCCATCAAGCAGACGTCCTTCACCATGGCCCTCAGTGTGATT
GAGCTGACGGCCCTCGTCCTCGGCAAGCACGTCGAGGCCATCCGGGCGTTGGACGCAGAGGCATTCCACACCAGCAGGGG
TTGCATTGTGGAGACGCTGCTCGACCTCCTGGACCTCTACACCCAGTTTACTAAGGCGACGAAGATCGGGCCGCGCTTCA
AGCTCGACAGGTTTATCGAGATCAAGATTAGGATCAATGAGGAGGTCGATGCAGGCCCACAGCTTGTCCGAATCGAGAGC
TGGTGCGACAAATGTGCGGCCGAGGAGCGAGACACAAATCCGATGACACCGAAATCGGCGACGTCGCCGGCCACGACGGG
ATCCGGGCCCGGCGGCAGCAAGACAAAGGCTGCGGGCCCGAAGCGCCAGGAGACGACTATGCGGTTCGTCTTCTCGGACG
AAGCTATGCGCCATGAACAATCGGAAATGGCAAAGTATTTCGCAGAGGAGTACGAGGAGTTCGAGGCCGAGGTCGAGGAG
TCGGTGCCGGAGCCGAACCCATACAACCACAAGGGGCACGTGAACAGCCACAACGGCCACAGCCACAGCCACAGCCACAG
CCACAGCCACATCAACCACAACAATACTAGGGGTGGTCACGGATCCCGTCGTGACCGCTCACACAACAACCGCCACCATC
AGGGAAACAACAACAGCAGCAACAACAGCAACAACGACTCGGGATGGGGGCCGTATCACCGCAACCGCAGTAATGACCAT
CCGCGTCATAAACCGAGAAAGGGGGGGTACTACCAGTAACAGTCTCCCACATGTTCTCGCGGAAGTTCCAGGGATGTCTT
TCGCTCTCATGCAACTCGCTGAGTGATGGGATGATGGGTGTGCTGAGCACTGTTAGCTTTGTCCTTGTGGCACCCTTCAA
GGGGCCTCTGGGGGGCGAAGTGCGTGTTATCCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62