GenePrediction:GLEAN_4007 Details

Name: GLEAN_4007
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2203936..2207086 (+ strand)
Length: 3151
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2203936..2204276 (+ strand)
Length: 341
Type: CDS
Source: GLEAN
Position: GCSC_113:2204509..2204744 (+ strand)
Length: 236
Type: CDS
Source: GLEAN
Position: GCSC_113:2205117..2207086 (+ strand)
Length: 1970
>GLEAN_4007 class=GenePrediction position=GCSC_113:2203936..2207086 (+ strand)
ATGGCGTGGAACAATAGCAGTAACCCGTCGGCGGCCCAGCGACAGCAGCTGCAGCATCGCCGCCACCGCCAGCACTACCG
ACTTACCAAGGCTTTTCCCAAGGTGCAGCAGCAGCAACAACAACAACAACAACAGAATTCTAACGGCACGGCGATGCCGC
CGTCACCAACATCGTCAGACGACGCCCATTGCGGTGGCAGTCGTCGCCGCCAGTGGCAGTGGGCTCGGTCGGCTGACTGG
GACATGCATCGGGCCCGCATCACAGAGCTGTACCGGGATCGTGGTCTGCATCTGGATCAGGTCATCGAGATAATGGCTCG
AGAGCATGGATTTTATGCGAGGTGAGCTCTTTCCGTTTCTGCTCTTGCCTCTTTTGCGCTTCCTTGCTCTGGCCCCTCCT
TCCTCCTTTGGTTTTGGTGAAAATGAAGATGAAGTGATGAGAGAAGAGAATATCTTCTCACCCAACTCTCTTCAATCTTC
TCGTCCTTTTCATCATTACTGTCGCCTTTTCTTCTTTTCTCCTCTTTCTCCTTTCTCTTCTCTCTCTGTCCTCCCTCACC
ACTAATTTCTCAGTCCCCGAATGTACAAAACCCGCATCAGCAAGTGGGCCATCGACAAGAACTACAAGGCGGCTGATGTG
GCTTGCATGCTGCTTCTGAAGCGTCAGCGCGCAGCTCAAGGCAAGGCTTCGTCGTTTGTCCTGCGCGGCCGCCGTGTCGA
CTGGGCCAAGATCGAGCAGTACCTCAAGCGTGACTCTACGCTGCTGCATCGTCTCGAGGCCGGTGACGACCTGTTAGACC
TCGTTCCCGGTCACGCCCAGACGTCTGGCATCCTATGCCGCACGCCGTCGCCATCACCTTCGCCGCTGCCACTTCCGCTG
CCAACACTTCCGCCGCAGCGTCGTGCCACTGTCGCCGTGCCGCTTTGCAGCACCAACAGCATCAGCAGCATGAGCACTTT
GAACAGCAGCAGTGTGCACAGCACCAGTATGAACAGCAACAACATCAGCAGCAGTAGCATGAACAGCAGCAGAATGAACA
GCATGAGCAGCAACAACAGCATCAGTGGCACATCCTCCTGGGCCGCTCCGCCCGCCTCGTCGCCTGTGCCTATGGGCATG
GGCTTCCACCCCTATCTCGCCAATTTGACGCGTCGCCACGGCAGCATTCCCACTATATCAGTGCCCAGCCTCTCTTGCTC
GGCCTCCTCGTCGCCGGCTTCGTCGGCCTGTTCCTCCGCCCTGCCGCCACTACCACCACCACATACGCAACAGCAGCATC
AAACACCAGCCGGCAGCGGCTTTTCACATCTCCACCACTCTCATACGGCACCGCTGTACACTTCGCTGTCGTCGTCTGCC
TCGGCCTCGTCGCCGCCAGCCTCGTCCTCGGCATCTCCGTCAGCTTTTGGCTACTATCACTACCCGCCGTCTCTGGTGCC
TTTGTCCTCGGTCGCCTCGTCAGTCTCGGTCCCCCCCGGCCTCACAGCCGTCTCTTCTCCCTCACGTGGACTCGCACCTC
CTCTTGAGGTCCGCCTTTCCGAGGAGCTCGCCCGGCTGACCCGCGACTACTGTCTCGGTGCCTTCGACAAGGGCCTCTGG
GTGCGCGACTCGACAGCCACGGCCGCTAACAACAGCTGCTGCAACTTTGTGTCGATCCTTGGCAGCCAGGACGGCGCCGA
CCGGCTGCGACTCTGGGGTCAGAAGATGCGCCTCGGCCACCATCTCATCGGCTCGGGCTCGCTGGACGACGGTTTCCGCC
GTGTCGGCCTCTGCATGGATGAACTTCGTCAGCACGTTCAGGAGGAGGACCCGTCTCTTCTCTTCCATCTGATGGGCCTC
ACCTTTGGCCACACTCCCAACTTTCGTGCCCTGGCTGCTACCCTCTGTGGCCACATCCGCGAACTGACCCATATCGTCCT
CGGCGCCGCCCACCCGTTGACGCGCATATTTGTCCGACTTGCCACCGTCGTCACCTCGGACGCCCATTTCGCCGTCCTCG
CCCTGCCTATGCAGTGTATGGCCGACCTTTTCATGGCTCAGGATGCTACACTCTCACTCTCGCTCGCACGCGCTCGCTAC
CGCTCCCAGTCGGTGCCCACTGTCGCTGTGTCTGCCGTTGCTGCTTCCTTCTCCGCATCCCAGAACCACCCCGACAGCCA
TCCGCTTTGTGGCCGCTTTTCCCAGTTACTGCTCGGCTCCAAGCGGCCTCTTCGAATCACCGTTCCCGACAGTTCGGCTG
CCGCTGCCGGTGTCACCGCCTCGCTCTCGTCGCCACCCTCGTCGCCCGTTGTCAAGACTGAGCCGTTGCACGGCGGTTCC
GCTGCCTCGCCCGCCATCGTTCGGTATCCCATCCGTGGAGCCCTCCCGGCTGAGACCCAGGCCGAGCTGCAGTCCATGGT
CGGCGCCCTTGAGACCTCGCGCAATATTCATGTTCGCATGCGCTTCTACCACATATATCTGGCTTATCTCTCGCGCGTCG
CTCTGGCTGCTGCTACCGGCTCAGATACCAACTCGGCCATTGCAGCCTCCGCCATGGCCACAAGCAGCCCCGGTGGCACC
TCGGTCGTCTATCACGGAATGACGACCGACTCGTCTATCTTGACGTCGTCCCAAGTCGCCACCGCCACATCAGCTGCCAT
CGCTGCCGCCGCTGCTGCCCACTCGCACTCGTCGCCGCCCTTCTTGGCTGCCTCCTCTATCACACCCGACAGCGGCAGCA
ACAGCAACAACAGCACCAGCGGTTACCATGGCAATAGCGCCTACACCGTCTCCGCCGGCTTCGCCGCAAGCGCCCATGAC
TACCGCACCAACCTGCTGACGATGCGCGAGTCGCAGTACTTTTACATACTTGGCGTCGATGTCACCCAGCCCGAGTCTGC
GACAGCACCGCCGCTAGCCAGCATGCCCTCAACACCCACCATGGTTGTCGCTTCTGGTGTTGATTATGGTGCTGATTCTG
GTGCTTCTGCCGACGCCACACCACGCACACTCGTGCCAGTCCCTTCGCACAAAATTATGTGTGCCTCCGGACTGGCTACC
GAGATGACTGACGTCCTAAAAAAAGAGGGAGATTACGACATGACCGGGAACGAGGCGTCCATGAGTTGCGAGCTCGAGGA
CCTCGTCAATGTAAAGTGGGTTCTGCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62