GenePrediction:GLEAN_4008 Details

Name: GLEAN_4008
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2212398..2214932 (+ strand)
Length: 2535
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2212398..2212559 (+ strand)
Length: 162
Type: CDS
Source: GLEAN
Position: GCSC_113:2212620..2212913 (+ strand)
Length: 294
Type: CDS
Source: GLEAN
Position: GCSC_113:2212972..2213081 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_113:2213138..2214932 (+ strand)
Length: 1795
>GLEAN_4008 class=GenePrediction position=GCSC_113:2212398..2214932 (+ strand)
ATGGACGCCGTCGACGAGGATGCGCAGTTCTTTGTGCTAGAGAACCGTCTGGCCTCTTTCCAAGGCCCACAACTTGTCGC
TAAACGGAGAACATCAACTGCCGCCAGCGCTCGCGCCCCCAAAACGTTGACATGGCCTCACAGGTCTCCAACTGCCATAG
ACGTGCGTTTTTTCAGGCCCGAGAGGACTGTACAATGATTTCCCACCTACTGACCCGATCAGCTTGCCCGAGCCGGCTTC
TTCTTCAATCCCCAACCGAGCAATCCCGATAATGTCAAGTGTTTTCTCTGCCACAAGGACCTGGACGGCTGGGAGGAAGA
CGACGATCCGCTGCAGGAACACCTGAAGCACTCCGGAAATTGTGGCTGGGCTATCTGCGCCGCCATTGAGCTGGAGCTTG
GCGATGTCGTCAACGAGGATCCGCGTCTCTCATACCTCGTCGAAGCCCGCAAGTCGACCTTTGCTGGGCGGTGGCCCTAC
GAGAGCAAGAAGGGGTGGAAGTGCAAAACCAAACAGGTAAGCCCAATCCAGTAATCAAAATCCCATTACTGTCTGCTGAC
ACTGCGCTCCAAAGCTCGCCGAGGCTGGTTGGCAGTACACTCCCACGCTCGAATCAGACGATAATACGACCTGCGCCTAC
TGCCAGTTGGCGCTGGACGGATGGGAAGCCGGGGACAAGCCATTGTAGGCTACTTCTTGCTGTGAACCTTCATCCCAACG
GTCCGGCTAACACTTGATAGGGAGGAACATCAGAAACGATCGCCCAACTGTGCTTTTTTTCAGCTGATCAGCAAGTACCC
CGCGCCGAAGAAGGCGACAGCACGAAGCAAGGCGACGAGAACATCAAAAGTGTCCCGACTATCGGTCCAGTCTGTTGCGA
CAGCGGCGTCCGATGCGCCGTCCACGGTCGACCTAGATGACAGCATCCTGACGGCCACATCAGTCTTAACTCAGGGTGGG
CGTAAGGCGCCGCGGGCCCGCAAAGCTGCAGCGACGTCGGCAGCAGGAAAAGCACGAAAGACACGGGTGAAAAAAGACGA
GCCAGTGGAGATACTGTCGGATGCAGATGCCGATCCGATCCAGGAGATAGAGCCACCGGCACCAAAGGCTGTCCGGGGCA
AGAAGCGGGACAGTACCGACGTGGAGACAACTAACACATCACAAGTCGAAGCCCCGGCAGCGAAGAAGCGCGCAACGCGC
AAACGCGTCAGCAGTACTGTGGACGGCGATTTGGATCAGTCACAAGGCAGTAGTAACTATGCCATGTTCGATCCGGCAGT
GCCAGTGCCAGACGAGGCTGTCATCGAGACGGAGTTGCGGACACTTGAGAAGGAGATGGAGGTCGAGCCGGCCCTAAAAG
AGATGCAGGCTCCTAAGAAGGGCCGGAAAGCGGTAACACGCAAAGTGTCGAAGCAGACGCGGAAAGGCAAGGAGGCCACC
GAGACGGCCCGGTTGAGACCTGAGGTGGCCGAACAGGTTGAGGAGGCGCAGCCAGCGTCAGTCTTTGCGCCAGCAGTGGA
ACAGGAACCGCGACGAGAGCTCAAAAGTCAGCCAGAGTCGAAGAGCAAAGCTAAGAGCAAGGCCAGGGCCAGGAAGGTGA
TGCAGCAACCAGCAGCCATCGATGCGGACGAAGTCGATGAGCTGCACGAAGACAGCGTGACCAGCATCACAATCACAAAC
ACGACAGTGCACGAGACGACTGAAGCATCCGTGTCTGCACCTGCAGCCGCAGCTGTACTACCGAAGCGAGGACGCGGACG
GCCATCCAAGAAGTCGTTGGAGTTGCGCGCCAGCATTGAAAGTAATGCTGCTTCTGCTGCTTCTGCATCTGCGCCCACTC
CTGTTCCTCCACCAGAACCGGCTGCCATCCACGTCAGCATCACTCCTATGCCGGCGGCCCAACGGTCTTCCTTGGGCCCA
GTCGCAGTACCAACACCAGCAGGCGAGGTTGCTGTGGCCGCGACAAAAAAGCGGCAGGTCACAAGGATTCTTCCGCCGCC
TGCGCCTCCCCCAGCACCACATCGTGCCCCTGCTGCGCCAGCAACGCCGCGGGCGATCCATATATCACCGGTAGCCTCAG
CTATGCAGGCAGTCCTGTCGCCATCCCAGTCACCACAATCGTCAGATGCAGAGAATCAGCCGCCGTCATCGAAGCCAACC
GGTAGCGTCTCCAAGACGCGCATAGCGTTGGCACCTGTGCAGGCCACGGCAACGACACCTGTGCGCGCCGGATCTCCGTC
CAAGCGCAACCACACAATGGGCGGATTGAAGAGCACAGCACCCTGGACAGCAGTCGATGTCGAGGCCTTGTTCGACGTGG
ACAAGGAGAACAGTGATATTGTAGAGGGCCTGCTTCGTCACGGGGCGGATCTGAACTCGCCGGAAAAGGCGATGACGGTG
GAGGAGTTCATCCTCTACAACGCCGAGCAGGCAGAACGGCAGTTGAAGCAAGAGTGCGAAGCAATGGTGAGCAAGTTTGA
GCAGCAGGGATCGCGGGCCATGCAGACGCTGGAGGCGCTGGTGACGGAAGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62