GenePrediction:GLEAN_4009 Details

Name: GLEAN_4009
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2218111..2223949 (+ strand)
Length: 5839
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2218111..2220008 (+ strand)
Length: 1898
Type: CDS
Source: GLEAN
Position: GCSC_113:2221964..2223440 (+ strand)
Length: 1477
Type: CDS
Source: GLEAN
Position: GCSC_113:2223521..2223949 (+ strand)
Length: 429
>GLEAN_4009 class=GenePrediction position=GCSC_113:2218111..2223949 (+ strand)
ATGGAGCCAACCACAGCAGTTGCAGGCGGCGTTGTACAAGCAAGCGAGCCGGCGATACACCAGACAGACAATATCGGATC
GACTGTCTCCAATACAGAGGCTAGGACTGCAGAGTCCCAAAGTGTGACCACAGACACCATGGTTTTCCTACAGAGTGCAG
GACAGGGTGTAGATACAGAAGTCACGGCAACAGAGAAAGCACAGGAGACTGGCAAAGATGTGGAAATTCTCAAAACAGCG
GAGGACAGTGTGGCCACCAATTTCGAAACTGATGTGATCTCTGTTGAGGTGAACAAGATTGTGCCGACAGTAGACAGCAA
AGCATCACAACCGGAAGCAGAGGAGCCAATCCCTGCAGAGAAAACGGCCGAAGATCAACAGGCTGAGCAGGCGGCTGACC
CGCATGTCATCGATGCCTTGGAGGCCGCACTCGAGGGAATGATGGAGGTTGACGCCGCAGCTGGAGCGCAAACAGAAGAA
CTGCAAGAAAATGAAGAAGGAAACGGCGGAGAGGGCGTTGAATGGGAGGCTGATTCTTCACCGTATGAGTCATCTTCCGA
CTCGAGCAGTTCTGATGACAGCGACTCGGAGGAGGAGGGGGATGCGGCCGGGCTGCCTGGGATCAGTGATGCCGTCCGCA
TGCTGATGCATGCTGCCATGGAGGAGGACGAGGATGACGAGGACGAGGACGGCAAGCGTGGCGGTGGTGGTGGTGGCGGT
ATGCATCTGCGAAGCAAGAACGAACAGATCGAGACGGCACCGCCCAAGCCGAACGTGGAGATTGGTGCCGACGAAGCGAT
TGTGCTACTGGGGCCGATCATGCACGTGGTCGAGAACTCGGCGGTGATCAAGGGCAACACAGACGGGGCGTACCGCGTGC
TGGATGCGGGCTCAGTGATCTGCAAGGCCGACCGGACCGTTGTCGGCGTGGTGGCAGACGTTATCGGCAATGTCCGGGGT
CCTTTGTACGTGCTGCGCTTTGCACCGGCTGCTGCCAGCGAGCCTGCGGCCACAACGACAGACACGACAGGCAAGGATGC
CGAAATGAACGCGGGCGCCGAAGCCGTACCAGAAGCAGCGGCAGCGGATGCACCGATGCAAACGGGTGCGGGCGAAGACC
ACCTGTTGCCGGGAGAGGACATGTACTACCCACCGAAGCATGCCGTGTTCGTGTTCACCGAGGAGCTGCGCGGTCTGAAG
GGCTCGGACGCCAGCAACCTCCACGACGAGGAGGTGGGCGCGGACGACATGGAGTTCTCGGACGACGAGAAGGAGGCGGC
ATACAAGCGGGATCTCAAGGCGAAGAGGCGTGGTGGCGCCGCGTCAGGCGGAGCTGCAGGCGGCCGAGGCGGACGGGCGA
ACCGAGGCGGCAAGGGCGGCAACCATCCGCTGCGCAACGAGATCGCCAACGGCAACGGCGGCGGGTTGCAGTACGACGAC
GAGGACGACGGTCCGTACAAGCCGCTGTCTCGGCCGGCCAACTTTGGCCAGGGCCAGACGCAGCCGGGTGCCGGTGGTAG
TGGTGGTGGCAGTGGCGGTGGCAGTGGTTCGTTCCGGGGATCCCAGAGAGGACAGCACGGCCATAGAGGTGGACGAGGCA
ACAGGGGACACCGGGAACGCGGAGGCGGATTCAGTCGCGGTGCTGCAGACAGCTATGCCGGCGGTGCTGTCAATAGCCGC
AACGGAACTGCAGACGGCTATTCTGGCGCGTCGCAAAACCGGTTTGGCTCGCCGCAATCGGTTCGGCCGCCACAGCAGCA
CCAACAGCATCAGCAATACCAGCAGCCGAACACGCCCATCTCTCTGCCGTACGTCACGCCATCACAGACATCACAGACGG
CACAGCCGGCTGCTCCCTGGCCGTTTGCCGGAATGCCCTTCCCTCCTCCTCCACCGCAGTACGCAGCTGTCGGAGCAGCT
CCTGGAGGAACCTATGGGCATGGTCAACCGGCGGTGGCACCGCCTCCCGCAGCAGCTGTTGCCGCAGCAGCAGCGGTCCT
GAACCAGTTCAACTGGCAGCAGCAACAACAACACCAGCACCAACAGCAACAGCATCAGCAGCCTCAGGTCACATTTCCCT
TCCAGCAGGCCGTAGCTCCGCCTTACGGCTACCCGGCACAGCAGCAGCAACAGCAGCGGCAGGCCTGGCCCCCAGCACCT
CCACAGTCAGCTGCCACGCCCGGCTTCAATCCTGCAAGCTTTTCCTATTTCATGCAAAATCAAGGTCAGGGACAGCCTGG
CTGGGGACAGGGTCAGCCCCCTTCATCTTGAGGATGGCGTTTGGAAATGTTTATTTTCGGATGGGAACATTTGCGACCGG
AGTTCGAACAGGACTTCTGAAGGACTACAAAATACGGGTATAGATTGCGAGTACATAGGAGGAAATCGAGCACTTTCAGT
CTAGTCGGGGATGTCGATGAAGTCCGAATGGTGCGACCGAGTGGTTCCGCGTCTTTTTTCCTGTCGTATGTACATACATA
GTAATAACCTTAACCTACGAGTACGTCGTACTCTCTGGGCGGGTCTGTAGAATACGACGTTGGCGCGACTTTCGGCTGTT
GACACCACGGGCGCTTGCCGCCCAACACGTCATTAGCAATGTCTTGGGCGGACCCTATGCTAAAGGCATGGAAATGGCGA
TCGTCCTGTGGCAGTCCGCCCGGTGTTTCAAAAGGCAAGGCGTCCTAGCCAGTGAGTGGGGAAGAGATAAGGTACATACT
TGTGTCTGGGTAATAAGTCGCAGACAGCAGAGGTAAACCGTACCTTGCCACCGACAGGCTCCTTCTTGTTTTGAAAGTGG
CTAGGCGTCTATTTTGGAAACAATGTGCTTGAATCACAGGCAGGAGCGACCATCCTTGCCGCTCTACGGAGTACTCGTAC
GCGTCGTGATCAAACGGACAGGAATGATTCGACCGACAATGCTTCCAAATCGATGACCACGACCACGATCACAACCACGG
CCACGACCGCTCGAAGACGCACCTTATCTTGCCAGGCCCGTGCACGGATTCCGCATAAACGCACCGCAAGATGCAATTCA
CAGAGCACAACAGTAGACGAAAAAAAACACTTGCTACGAGGGAATTTTCAAAGAACTTTTCCATTCTTCATCGATAGGAC
AGACGCTAGCAACGCGAACCCCTGGCCTAATTCATTTCGTTTTGTCTTGGGTCAGCCAATGGGAGCACTGGCGTGCCTGG
ATGGGCTCCTCTAAGCCCCGTTCGATGGGCCTTTCCCCCGATCTGCAGGCACGAGAGTCACCCCCCCTGTTCGACGGGCT
GCAGGCAGAGGACAACAGAAGAGACAGCGCAAGCCAACTGGTCGCTACCCTGGCGCATCTCGTAAGATACGACGCGGACA
TCCACCCGTCTCGTGGTGCTGTCGACATACAAAGTACAGGGGTCAATAACACCTGCTCGTTGGGCTGAAGAGGAGACAGG
CCAGGTTCAAGTGGCTCTCTTCAGCGGTTGTCCCCATTCACCTGCAGCGGCCCCTCCTGCAAGTCGCATCTGCCCTCTTC
TTGTCCACATTCCTTCTTTCGGTATTTTCTCTGCCTCGTGCTGCAGGTCCTCCCTCTCTCGACCAACTCCCTCTTTCATG
GTCTCTGTTCCTGGCCGCGTTACCTCTCGCACTCACTCTCTTTTGCAACGTCTCTGAACGAGACCGACGACACTCTTTTT
ATACCGCAACATTCGTTTCAACTCGGTATCTTACCCATTACGCGCCTGCAACTAGACAGGTCACAAGCATTCCATTCCTT
TGGCGAGATAGAGCATTCTTCCAAAGAACAACACACAACACCCGTTTCACGACAAACGCCAGCCAACTTGAACGCCGCTG
TCCTTCTTCCCAGACACGGAAGAGCTGCCGAGATGGCGCAAGCACCACAACCAGATCACCCCCATGGGATGCTAGCCCGC
GACATTTGGGACAGCATTACCAGCGCCGTGGGAGATGTCTTTGAAGGACAGAAGGGCAAGACTGTAGTCCAGACCGTCTA
CACCACACAGGTGCCTTCGGGCTACACCGGAGCCCTGACGACTAAGACAGCTGCGGCCGACGACAAAAAGACGACAACAA
CAGCTGCGAAGAAGGAGACTACCACATCAGCCAAGGCGGTAACGACGACGACAGCGCCGACAAAGACAACGAGCGCGACC
ACTACCAGCGCCGCCAAAACAACGGCCACAACCAAGGCGACCACAGCCACGGGGAAGACGACCTCGACTCCGACCTCGGA
AACGCTCGACAGCGCCACGAGCTCCTCGACCAAGACGACCGGAATGACTACGTCCGAGACCGCTGCGCTGACCTTGGACA
CGTCACCGACAGCAGCTTCGACCACGTCGGCCTCGCTGACCGCCAGCTCCACGTCGGCAGCCGCGACGGCTTCCAGCACC
TCGACGACCACCGGCGGCACCAGTGCCGGGGCCAAGGCCGGCATCGTCATTGGTGTGCTGGGCGGTCTGCTCGTCGTGTC
TGTCATTGTCTTCTTCCTGTTCCGCAGGCGCAAACAGCAGACTCAGCGTAGGCCGCTAGATGACGACGAGAAGGTCAACG
GACCATTCGGTGACCATGCTGCCATTGGAGGTGGCGCCGGAGGTGGTGCCGTGCTCACCAGTGTTGCTGTCGGTTCGGCG
TCTTCACGTCTCAGCCTGCGTCCATCTGGCCAGTTCCTGCCCAACCTTGGCAACAGCAGCACTGCTACGGCAGGTAGACC
GCAACAGCAACAGCAACAGCAACAGCAACAGCAACAGCAGCAGCAGCAGCAAAAGGACAACTACCCGAACCGCCGAGCCA
GCCACGGCTCTACCATTGCTCTCCAAAACCAGGCACCGATGGCCAACCGTGGAGCTGGCACCAGCGCATGGGAACGACCG
TCGACGAGTGCTAGTGCCGTCAGCAACCCGTTTGGAGACAATGCCGAGCATCCGGCATCGTCAAACTCGCCGGCCTTGCA
GCCGTCTACCAGCCCCGGCGGAGCCGCTGAAGCTGCGGCTGCTGGTGCAGGCACTTCGCTGATCCGCAAGGCATCTATCC
GCAAGGATGGGCCCAGCACCCTGGATCTCACTCTGACCCCACCGGTCATTGGGGCTAGTTTGGGCCCCGTCCCTGCCAGT
CCCGCCGGTACCGAGTTCAGCTTCACGTCCGAGTCGACCGATCGTCCTCAGGGCCCTTCGGTCAGCGGTGCAGCTATTGC
CGCTGCGGGCGGCCCGGCCTCTTCCACCGTGCACCGCGTTCAGCTCGATTTCATTCCCACGCTCGAGGACGAGATGGAAC
TGCGCGCCGGTCAGCTTGTCCGTCTCCTCCACCAGTATGACGATGGCTGGGTAAGGGTTTCTTTTTTTTTTTTTGAGACC
TCTCCAACCCGAGTCCACCAGTTCAACCATGGCTAACATCTTCGTGTCAGGCACTGTGCATCCGTCTTGACCGTTCCCGC
CAGGGCGTGGTGCCTCGTACCTGTCTGTCTGCCCGTCCTGTGAAGCCTCGTCCCCCACCGGGTGGAGGCCGTGCAGGCCC
TCCGATCAACACCGGCGGCCAGCCCCGCCCGATGGGTCCTAAGAGCCCTCTGAGTCCTATGGGCCCTCAGATGATGAGCC
GGCCACAGCCCCCATATGGTGCTCCTCAGAACCGGCCCTCCTCGGCGGCCGGTGGCCGTCCGCAGTCTCCCGCCGTGCGC
AATCAGCCGCCATACCCAACTAGCAGCAGCCAACCTCAAAGCCCCGTCGAGTTGCCGGCCCAGCAGGTCCGGCCGTCTGG
TTCAAGCCCGCTTGGCAGGACAGCCGGCTCGCGAACCGGCCCGATCGGTCGCAAGCCTGTCCCTGGTCAAGCCTATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62