GenePrediction:GLEAN_400 Details

Name: GLEAN_400
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1549664..1551651 (+ strand)
Length: 1988
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1549664..1550308 (+ strand)
Length: 645
Type: CDS
Source: GLEAN
Position: GCSC_167:1550376..1550531 (+ strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_167:1550600..1550758 (+ strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_167:1550842..1551444 (+ strand)
Length: 603
Type: CDS
Source: GLEAN
Position: GCSC_167:1551496..1551651 (+ strand)
Length: 156
>GLEAN_400 class=GenePrediction position=GCSC_167:1549664..1551651 (+ strand)
ATGGACCCCCTCGAAGAAGCACCCTGGGCCGATACTCCGCAGTCGACGCCGGCCGCGCACGAAGAGGGATCCGCGGCAGC
CCCGTCGTCTGGGGCGGACAAGCCGTCTGCTGACACGACATCCTCGGCGCCGGCCTCATCTGGGGGCCGGCCGGCACGCG
CGGCCCCTCGCCGACTGGTGGCTCAGCCCACGCGGCTACAGGCTGTCGAAGACGATCCTCTCGGTCCGCTCGGTGCGCTG
AGCAGCAGCACATCGACGCTGTTTGGCGCCGATGTTTCGACCGAGCCTGCCGCCACCGGTCTGGAGTCGCCGCCGGCGCC
GCCCCTGAAGGAGCTGCCGCTGCGGTCAACCATGCCGGCGGGTGCCGGCAGCAGCTCTCTGCGTGGACCGGCTGACCCGC
ATCGCATCGACATTGACGATCTCGACGGTGGCGGCACCGGCGGCTTGTTTGACGGCCAGTCGGCCCGTGGCGCCAGAGTG
CCGCCGCCCGTGGCCGCCTCCGTGCCGACGCCTATGCGAACAACAAGCCGGCCGAGCGTGACGATCGAGCAGGCCTCCAA
GCCGAGCTTCTACATCTCCGTCGGCGATCCGCACAAGATCGGCGGGGCCACCGGCTCGCACATTGAGTACAGCGTGAAAA
CACAGGTCAGTTCCGATGTCGTGTAGACATGTCTGTCCCTCGCTACAGGTTCTAATAGGCAATATGCGGCAGACCACATC
CAAGGCCTACAGACAGCCCGAGTTTGTCGTCAACCGACGCTATCGCGACTTCCTGTGGCTGTACAGCCAGATGCATGCCA
ACTGTCCGGGCGTGGTGGTGCCTCCGCCGCCGGAGAAGCAGGCCATGGGCCGGTTTGAAAGCAACTTTGTGGAGTCGAGA
CGGGCGGCGCTCGAGAAGATGCTCAACAAGATTGGCGGGCCCATCCGACGCTGCAGCAGGACGGCGACCTGAAGCTCTTC
CTCGAGAGCGAAGCCTTCAACGTGGACGTGAAGCACAAGGAGCGGAAGGAGCCGAATCTAGGCGAGAGCAAGGGTATCAT
GAGCAGCCTAGGCCTCAGCGTCGGAGGCGGCGTCAAGTTTGTGGAGCAGGACGATGTGCGTTGGTACCTGGGCGTGGTGG
CCTGACTGGCCTACGGCCTGTTCCTTGCGCGGACCGACAGCTAACAGACGTTTCGCAGTGGTTTCACGAACGGCGCATCT
ACCTGGACGCGCTGGAGATTCAGCTCAAGTCGCTGCTGAAGGCGATGGACAGCATGGTGACGCAGCGCAAGTCTATGGCC
GACGCAGCGGCAGACTTCTCGGCCTCGCTGCACGCGCTCTCGACCGTGGAGCTGTCGCCGAGCCTGTCGGGTCCGCTCGA
GGCGCTCTCGGACCTGCAGGCGACGATCCGTGACGTGTACGACCGGCAGGCGCAGCAGGACATCCTGACGTTTGGCATCA
CCATTGACGAGTACATCCGCCTGATCGGCAGCGTCAAGCAGGCCTTTTCGCAGCGGCAAAAGGCCTTTTACAGCTGGCAC
TCGGCCGACGCCGAGCTGCAGAAGCGCAAGACGGCCCAGGACAAGCTCCTGCGCCAGGGCAAGAGCCAGCAGGACCGGCT
GAACCAGATCGGTGCCGACGTGGCCGACGCCGAGCGCAAGGTGCACCAGGCCCGGCTGCTGTTCGAAGACATGGGTCGGC
TGATGCACAACGAGCTGGACCGGTTCGAGAGAGAAAAGGTGGAGGACTTTAAGAGCGGCGTGGAGACGTTTCTGGAAAGC
TCTGTGGAGGCACAGAAAGAGGTAAGCCGGAGGGCTCCCCGATGGATGTGTCCGTTTACTGACTTGGCGCAGTTGATCGA
AAAGTGGGAGACGTTCCTGATGCAGCTCGACGCAGAGGATGACGAGACGGCCTTTTACAGACCCCCGGTCCTGCAGTCGG
CAAGCCGGCCGGCCGGCGACACAGCCATAGACCGAGCCAGAGCACACATTGACGAGGACTCTGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62