GenePrediction:GLEAN_4010 Details

Name: GLEAN_4010
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2228079..2232283 (+ strand)
Length: 4205
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2228079..2229290 (+ strand)
Length: 1212
Type: CDS
Source: GLEAN
Position: GCSC_113:2229600..2231202 (+ strand)
Length: 1603
Type: CDS
Source: GLEAN
Position: GCSC_113:2231301..2232283 (+ strand)
Length: 983
>GLEAN_4010 class=GenePrediction position=GCSC_113:2228079..2232283 (+ strand)
ATGAGGACACGGTGGACGACGGTGGTCCCGGCTTTGCTCTCGGCGGTGGTGGTGGTGGCTCTGCTGGCGAGTCCGGTGGC
GGGCGAGCACACGAGCAACTGGGCAGTGCTGGTGTGCACGTCGCGGTTCTGGTTTAACTACCGGCACCTGGCCAATGTGC
TGTCGATCTACCGGACGGTGAAGCGGCTTGGCATCCCGGACTCGCAGATCATCCTGATGCTGCCGGACGACATGGCGTGC
AATCCGCGCAACGCGTTTCCCGGGACGGTGTACTCGAATGCGGACCGGGCAGTGGACCTGTACGGCGACAACATCGAGGT
GGACTACCGGGGGTACGAGGTGACGGTGCAGAACTTTATCCGGCTGCTGACGGACCGGGTGGGGGAGGAGATGCCGCGCA
GCAAACGGCTGCTCACGGACGACGGCAGCAACATCCTGGTGTACATGACGGGTCACGGCGGCAACGAGTTTCTCAAGTTC
CAAGACGCGGAGGAGATCGGGGCGATCGACCTGGCGGACGCGTTTGAGCAGATGTGGGAGAAGCGGCGGTACCACGAGAT
CCTCTTCATGATCGACACGTGCCAGGCCAACACGATGTACAGCCGGCTATACTCGCCCAACATCATCGCGACCGGATCGT
CGGAGCTGGACCAGTCGTCGTACTCACACCACGCCGACAGCGACGTGGGCGTGGCAGTGATTGACCGGTACACGTACTAC
AACCTCGAGTTTCTCGAGACGCAGGTGGCCGATCTCGGCAGCAAGAAAACGGTCGGCGACCTGTTCGACTCGTACGACTA
CGAGAAGATCCACTCACATGCCGGCGTGCGCTACGACCTCTTCCACGGCGGCGCCGAGGCGGCCCGCAGCCGTCTGGTGA
CGGACTTTTTCGGCAACGTGCAGAACGTCGAGGTGGACGGGGAGGATGCTGCTGCTGCTGCTGCTGCTGGGACCACAAAC
AGCACGCTCGAGGAGGATCTGCTGGCGATCAGCCGGACGATCGCAGCGCTGCAGAAGCGGGCAGCCGAGGCCGAGGCCAG
CAGTGCAGGTGCAGATGCAGATGCCCGGGCAGCAGGAAACGCATCGCGGCCGACAGGCACGGGCAAGACGCCGTCGGCAG
TGCAGTTGGCCAAGCCGCTCACCGACGAGCACTGGTGGTCAAAAAAGGTGCTGGGGGCGACGACGCTGGCTGGATGCGCG
TTGCTTTGGGGTGTCAGCTCGTACCTGGAGGCGTGAGGCTTCGGATGTGTATATCTTGTATCATTAATGACGGCCTGGCG
TTGGTTTGGTAAAGTAAGCCGATATGATCTGGAATTGATCTGCCTTTTAAACGTATTAGTGACCGAGCAGAGGGCAGAGA
GCTGAGCTGAGCTGAGCCGAGCCGAGCTGAGCTTCGAGTTATGGACCCCACCATGGAATTGGATTTGTTCAATTTAGGCA
AGCACGCGTCGCGCTATTCGTAAGGAGCGTTTGACATCATGACGGATGCAATGACTGGACCGAGAAAAACAAGGGTAAGA
GGAAGAGCAGAAGAGAACAGAACAGAAGAAGAGCGGAGGCGCGGTTGCTGATGCGCGACAGAAGCGGCACAAGGCGACGC
CACTGCGGCCGCTGACGCTTCGATCGGCACCGTTTGCGAAACGGGCGCTGGCCTGGTCACCTGACGCCGAGTTGGCCGTG
GCTGCCGACGACTCGGTGTACGTGTTTGTGCCGCAATTTGGGGATGAGGACGAAGAGAGCGTGGAGGGAGAAGAGGAGGA
GGAGGAGGAGGGCGTGGTGAACGACGGGGACGAGGACAGGAAGGCGGACGGCGATACGGCCATGGGCGAAGGTGGTAACG
GATACGATGCACTGATCTCGACCGAGACGGAGACACGCAGCCAGTTTGCGGCCGGCAGTCTGCACATTCCGGTATCGCAT
CCGCCGCTGGACGTGCGCGTGAACCAGCGACTGTACGCGGCAGCCGGCCTGCCGTTTCCGTTTGGGAGGGACGACGAGGG
AGGCGACGATGAGACAGTCGAGACGGGAGAGCCAGGAGAGCGGGAAGAGCAAGAAGCAGAGCGGACCAAGACGCGAGGAA
AGGCGACGACGACGACGACGAGCGCACGGTCGATGCGGAAGAGCAGCAGCAGCCACTACCGCCGGCCAGGCGGTGCCGGA
GCCGGTCCGTTGACGGCTGTAGCCGGGACGATGAACTCGGTGGTGGCGTTGGCCTGGTCGCCAGCCGGTGTTGGGCGCAA
CCGGCGGGCGGTGCTGGCGGTGCTGACGTCGGCCGGCGTGGTGGCGGTATACGGCGAGGGCGAGGGTGCGGGCGATGACG
ACGAGAAAGGCAGCCGACGGCCGACGCGACACTACGACACATCGCACTGGGAGGTGCTCTGGGCCGTGGGCGAGCGGCTG
GTGGTGCCGCCACAGACAGAGATGGGCGAGTGTGTGGTGTCGGTCGCATGGAGCGGCGCGCTGGTCGGCGGAGGAGCCCT
GCTGCTGTACCGGACAGACCAGGACGAGGTGGTGGTGCTGCGGGTTGGTCGAGTGGCAGGCCCGACGCCTTGGCAGGTCG
CAGAAGAAGCCCGGTTTGTGGCGGCAGGACCGCATGCCGGCATGCGTGAGACGACGCCGCTGGACGCGCACTTTGTGCCG
GGCGGCACGGCCTTTGGGCTGCGATGCAGTCCTTGGCTGGTCGTAGCTGAGGCGTGGCGGGATGGCGATGCCACGACGAC
AACACAGGTCTGTCTGGTCGGCTATCTGGCTTGCAATTATGTCGGCTTTCGTCGGCTGACCGTCACGACGACGACGACGA
CGACGACGACGACGACGACGAGCAATGCAGCAGACGCAGTGATCGTCCGGATCGATGCCGACGACGTCGACGGGCTCTGC
CTCTTCCTCGGCACCGACGCCTTTCTCGAGTGGGAGGACGGCATCTGGACGGTCGACGACAGCAGCGGTGGCAGCCGGGT
CTGTCGTGGCGTCGTGGCCACGCCGCTCGTCGCTCGGCCCTTTGAGGTCGTCTTGCTGGCCGCCTCGGCTGCGGCGGCTC
GCGGACCTCCGCCTGCACACGATCTGCTGGCCTGTGGCACGGCCTATCCGTCGGAGGACGAGGCCCGGACGAATCCAATC
CAAGGTGAGTGTCTTTCTTTTCTTTTTCTTTTCTTTTTTTTTTTGTTTATTTTTTATCTTTCTTTCTTTCTAATCTGTTC
ATTCTTTCTTTGTTCACCCCAGATCTCATTATCCACCCCCCTGCTGCTCATGTCGGCCCGCCCGCCTACACGCTCGTCCG
CCTGTCGGCCACGGCCACCAACGACGACTGGTACGAGACCGGTGGTGGTCCACCTTCTGTCCCCTCCGATCCGCCTGCCG
CTTGGCCCCAGTGGACGCTCGACGTCGCCCGCAAGATCAAAGTGAGCGCCACGCCCGGTGTCGGTGACGACGGCGGTGAC
GACGATGACGACGAGCTAGCCAGCGACAGCCTCGACCACAGCATGCTCGACCCCTCCCTCCATCCTCTCCGGCTGGCTCC
TGCCAGCGGCCCCGAGCTGTATCTACATCGCGCTCGTCTCTGGGGCCTGGCCCTGGCTCCTGGTGGTGTCGCCGGCGCGG
CTGCACGCGCTCGTGGCGTCACGGCCGTACTGGTCACCGACCATGCCGCCCAGCAAGTCGACCGTGGCGGTTGGTATCGC
GATCGCAGCCGCGTGCTGTTTGGCTGGCCCGAGGATGCAGCCGCTGACTCGGCTCCGGGTGAACTGGCCGATCACGTGAC
CAACTATCTCCGGCCCCCCATCTCGACCGAAGCCCACATGTGGTCCAACATGTATGGCCGCGGACCCCCGGTCTTGCCAG
CTGTCCGGACGCGACCACATACTCTCCTGCCCGCCGGTGGCGGCGCTCTCGCGCAGACGTGCACCATCTGCGGCGCGCCC
ATCGACGCTGATGTCCCCAGCTCCGGCCACGCCGCCATCGATACAGACCAGGTCGCTACCTGCGCTCGCGGCCATATCTT
TGATCGCTGTGGCGCCACCGGCCTTGCCATCCAGCGTCCCGGCGCCTCGCGCGTCTGTGGCGTCTGTGCCTGTCGCACCC
TGCGCGCCGATGCCGTCGCCGACATGGTCGACCGTCTCGGCGTCACAGCTGGGGCTGTCGAGGCCTTGCGATTGGCCGTT
GCTGGCGACATTTGTGGGCGCTGTGGCGGCAAGTTTCACGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62