GenePrediction:GLEAN_4011 Details

Name: GLEAN_4011
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2237184..2238714 (+ strand)
Length: 1531
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2237184..2237385 (+ strand)
Length: 202
Type: CDS
Source: GLEAN
Position: GCSC_113:2237510..2238714 (+ strand)
Length: 1205
>GLEAN_4011 class=GenePrediction position=GCSC_113:2237184..2238714 (+ strand)
ATGGCTCTCGGCGTCTCGCTCACCGGCGCCGCTCTGCTGGCTGTTCTGCTGGTGCTGGTCTTGGCCTGGCCGCGACGGTA
TCGGGGCGAGAAGCGATCGGTACAGGTGCTCGTGCTTGGCGATATCGGCCGCAGTCCTCGCATGCAGTATCATGCCCTGA
GCATTGCCCAGCACGCCCCAGTCCAGCTGATTGGCTATTATGGTAGGTAGGAGAGAGGTCCTCATGGGCCGGTCATTTCG
GAGGTGATCTCGGACCACGACCATGGTTCTTTCGATCTTTCTGTTTCTTCTCACCCCCCCCCCCCTCAGCTACTAACCCG
TTCCAGAATCGGACCTCGTCGATGAGCTGGCCCGCCATCCCCGGCTCACCCGCGTGCCGTTGACGGCCAGTCCGGCTGCC
TTGCGCCAGCTGCCCTTTGTGCTGGGCGGTCCGCTCAAGGTGGTCTGGCAGGTGCTCAACCTGCTGCTCGTGCTGGCCTA
CAGCACGCAGCCAGCGCGCTGGCTGGTCGTGCAGAACCCGCCGTCGATTCCCACGCTGGCCGTGGCCGCCCTCGTCGGCC
GACTGCGCAACACCCGTCTGCTCATTGACTGGCACAACTACGGCTGGACTATCCTGGCTGGCTCGCGGGCCGGTGGCGGC
AGCAGTGCCGAACGACACCCGTTTGTGCGTCTGGCCCGGCGCTACGAAGAGCTCTGCGGCCGTCTGGGCGACGCCAACCT
CACCGTCACCCGTGCCATGGCCTCCCAGCTGCGTGCGCCTCCCTACGCCGTTCCCTCGCCCATCGCCGTCCTGCACGACC
GCCCCGCCGCCCTCTTCCAGCCGCTGCCGCTGCTGCCGATTTCCCCGATCGATCGCGGCCGCGAGCTGGCCCGCATCCTC
GGCGACGACGACCTTGTCGACCATAACAGCGCCAAGGTCCTCGTCAGCAGCACCTCCTGGACGCCGGACGAAGACTTCCA
GCTGCTCCTTGATGCCCTCGTCCGCTACGTGTCCACGACCTCGACCGACGCTCGCTCCCCCATCCTTGCCATCATCACCG
GCAAGGGCCCCCAAAAGGCTTTTTACCAGGGCAAGATCGCCGCGCTCGTCGCCGCCGGCCAGTTGCCGCCCGACCAGATC
AGCATTTGCACGGCGTTCCTGCCCATGAGCGACTACGCCCGCCTCCTGGCCCTCGCAGACCTCGGCGTCTGCCTACACAT
GTCCAGCTCGGGCGTCGACCTGCCCATGAAGGTGGTCGACATGTTCGGGGCTGGCCTGCCGGTCGTGGCTTACTCTGCCT
ACGAGAGCTTTGGCGAGCTCGTACGCGAGGGCGAGAACGGACGGGGCTTCACCACCTCCGACGGGCTTGCCGACCTGTTG
GCACGGCTCCTAGACCCAAGAAATGGTAGTAGTGGCTCAGCAGAGCTCGGACAGCTGAGGATGGGCGCTCGGCAAGAGAG
CAAGCTGCGGTGGACAGAGGAATGGGAGCGGGTGGTCGCGCCAGTTCTGGAACTGACGGCAGAGGGAGACGTTCCGAAAA
AGACAAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62