GenePrediction:GLEAN_4014 Details

Name: GLEAN_4014
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2246486..2248275 (+ strand)
Length: 1790
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2246486..2246756 (+ strand)
Length: 271
Type: CDS
Source: GLEAN
Position: GCSC_113:2246834..2248275 (+ strand)
Length: 1442
>GLEAN_4014 class=GenePrediction position=GCSC_113:2246486..2248275 (+ strand)
ATGATTGTCGCTGATAGCTGCAATGACCACGAGAAGGACAGTGGCGACAACAGCGACTACGACTACGGCTGGGATCTCTC
GCTCGAGGAACATGTCAACCAGCTGCTTTCTCTCCAGACTGCTGCGCCCGCCTCGACGGCCCACAGCCCACACGGACATG
GCTCTCCGTCACGCTGTGCGGCCAGCCCGGCCAGGCTCGAGGCCAGCGCCGTCGAGCCGTCTGTCCTGGTCGATTCCGAG
CAGGGCAGCAGCAACATCGTCTACCCGGACTGTAAGACATGTTGGCTGCCTGCGGGTCTCTCCATGGGAGGAGGCATGTC
TGGCTAACGAGGAGCGGCTCCATTGCAGTGACTCACGCTCTCACCGATCTGGGCCCCAGTCCACTTAGCAGAGGCACTGA
CGCAGAAGCAGATGCTGACCAGTCCTCCCCCCTGGCCCGCTTCCGTACGGCGCCGCGCAAGCCGCTCTCGGTCAGCGACC
TGACGGCCGGCGCCTGGTGCGAGCTGCAGTACGAGTACACGCTGACGCGGCTGCCGGGGGGCCGGCGCACGCGCACGGCG
GCCATGCGGGCCGGCACCAAGGTGCATGCCCGGTTGGAGGAGGAGGTGCATACCACCGTGCGCGTCGATGTCGTCTCGCG
CGAGGATGTGCAGGGCCTGAAGCTTTGGAACATGATCCAGGGCGTGCGCACGCTGCGCGAGACCGGCCTGACGCGCGAGC
TCGACGTCTGGGGCGTTGTAGACGGCCAGATCGTCAGCGGCATCATCGATGCCATCAGCTTCTGCTGTCCAGACCCAAGC
CTGGAGGCCGAAGTAGTGGAGGCGACGGCGATGATGGGCCGGGGTGGCAAAAAAACAAAAACCCGAAAAGCAGGAGGCCG
GAAAGAGAAAGAGAAAGTGAAATGCAAAGACGAAGACGAAGCCAACAGGATCACCGACTACTTCTCCTCGCCGCCAAGGC
CGTCTCAGTCGTCCGGCAGGCCTCGGGAACCACCACCGCCACTGGAGCCAGTCCGCAAGGCCTACATCACCGACATCAAG
ACGCGCGGCTCCAGCACATTGCCGTCCGGCGCGGCCGTGCGGCCGACCAAGATCCAGCTGTTCCTGTACCACCGCTTCCT
GGCCGCCATGGCCGCTGGCCGGCTGGACTATGCGTATGTCTTCCAGCGTTACTCGCTCGACCCGGACGCGGCCTTTTCCG
ACGCCTTCCTCGCCCAGATGGGCGAGCTGCACGACGAGATATTCAGCGACGCAGATTCGGCGCCTACGACGCCTACCCGG
TCCAACGACGCCGCCACCGTAGTAGCAGCAGCGGCCGAACCGAGTCCGATGCGTTATGGGACGCTGCGCTCGCTCGCACG
GCTGCTGCAGGACGAGCTGGCGCTGACGTTTCCGCACGGCGCCGACTCACTGGGACGGTTCGTCGTCGCGGAGTATCGGC
TCCGGCCGCTCCGGCGGCGCAGGCGACCTCGTCAACAGACGGCTCGACAGGACGGCCCGTCAGAGGATGAGAAGAGCGAT
AACGACAGCGGCAGCGATGGCGGCAGCAATAACGACGAGTCTTCGGGTCGCTGCATCGGCACCAACGTCATTCCGGTCGA
CGATGCCGTCTTGGACCGATACCTGGACTGGTACCTGCAGTGGTGGCGTGGGCTGCGGCCGGCGACGGGCGTCGATATCG
AAGAGGCGTCGCTCAAGTGCGGCTACTGCGAGTTTGCGGACGGCTGTGGCTGGCGCAGCGCCTTGGACGAGGAGCGTGTG
AGACGCGTGCGCGAGAAGCTGGACCGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62