GenePrediction:GLEAN_4015 Details

Name: GLEAN_4015
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2250689..2255294 (+ strand)
Length: 4606
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2250689..2251465 (+ strand)
Length: 777
Type: CDS
Source: GLEAN
Position: GCSC_113:2251529..2253222 (+ strand)
Length: 1694
Type: CDS
Source: GLEAN
Position: GCSC_113:2253539..2255294 (+ strand)
Length: 1756
>GLEAN_4015 class=GenePrediction position=GCSC_113:2250689..2255294 (+ strand)
ATGGTCACCACAATGGCAATGACGAAGACGAAGACGACCACGACGACCACAGTGCCACGGCCTGCGACTGCGGTCGCATC
GCCAACCACACGGCTGGCATCCTACGGCACGGCCTGGCCTTCTGCTCTACCTCTGACGGCCATCTCGTTCAACTCTTCTC
GCGCTCCGGAACCGGCCAAGATGAGCAAGGCTCTTAGAAAACAGCGTCACCAAAGCCTGCCCTCGTCGCTACCGCTGCCG
CTGCTATCCTCGGAGTCCTTGGAATCGTTGAAGTCCGCAGGCACCCAGCTTCCGTCTCCCTCGGCGTCGGTTCGTACCTC
CAGGCGCCGTTCTGCCACGCTTCTCAGCCAGCCTGCTGCTCCCTCCATGTCCAAGAGTCGCTCGGCTGAGCGAACGGGTC
ACAGCCGCCGGGAACTGAGTCGGGACAACAGCGTGTCCATCAGCGTCCACCGTCTACGGAGCAACTCGGGACTCGCCTTG
CACACAAATAGTGCCGCCTTGCGGCGCTACATTGACTACAACCAGGACGGTTCTACCCGGCTGCCGCCCACGGGCGAGGC
ACAGGACGACGCCCTCCTGCAGAGCATCGGAGAGGGCATCTTGAACGGCAGCAGCCGCAGCAAAAGGGACCGGATCCCCC
CTGGAGCCCCTGACGGACCTGGTCTCTTCAGCCGCGAAATGGTCTTTGCCGTCCTCCAGGACCCAGAGGCCCGCCGTCGG
CTGTGGGACTTTGCTCGCAGCCAGAACAACGAGGAGAACCTGGACTTTCTAGAAAAGGTGAGTGCATGTCTTGTGCTTGT
TCCCTGCCGTTGCAGCCTCCAGTTTCTAACCCTGCTCCAGGTGGAGGAATACAACAAGGCTGTGCACGGAGTCGTGGCCC
TGCTAGCCGACATCTCCACCAGGTTCACCGGCCTTGCCGCTACCTGCTCTCTCGGCCTTCCCCAGACCCTTGCAAAGCCT
CTCACTGCCGACGTCATGCACCTTTCGCGATCCATCTTGCCCGGCCTCGAGATGCTGTTTGGAGCTGCCGCTGCCCACAT
CGAGGAGCGCATCATTCGCGACATCTACCCGGCTTTTATCAAGCACCAACTGGACCTCCGCATGAAGGCATCGCTGGGCG
CCCCCTCTGCTCGCGCGGCACAGGCCCCCTTCCGCTTCACTGGACTCGGTCACGCGTTCTGTCTGACCGACCCCTACCGC
CCTGACAATCCGGTGGTGTACGCCTCGGACAGCTTTGCTCACATCATCGGCTATCCCAAGGCTGAAGACATCCCTCGCAG
CGGCCGCTGTCTCAGCAGCCCCAAGATGAGGGCGCAACAGGCCAAGGGAGACGAATTCACGCAGGACATTGTTTTAAATC
GCCGCTGGTGGGACAAGCAGCCTTATTGGAGCCATGTGTCGATGTGCCCGTTGCTCTCGTCCCGAGGCCATATACGCTTT
TCCCTCGTTGGGCTGGTTGATGTCTCGGATGTGATCAAATCAAAAGACGGGATTTTGGATGCCCTGAAGTGCGACGGCCC
GGCCTGCCTTTTGCCGAAGAAAGGCGTCGATGGCTCTGAGAAGGCAGGCAACAGCTTACGCCGTAAGAAGGAGCGGCCTT
CATCTCTTATACTGGAGAATCCCAGCAACAGCAACCAAAGCAACAGTCCACAAAAGTCGCCAAAATCTGCGACTTCCTCT
TCGACCAAATCGTTGTTCAACCCTTTCTCTCGAATGCGGCGCTCTCCAGCAAATATCGCGTCTCCCGAGGACCGGTCTCC
TACGACGGACGAGATAAAAAACAAGCCCAAGTCGCCTGAACCAGTCTTGGGACTGTCAAAAGCCAGAACGCCCTCGCCCA
CCGGCGAATGTGCTGACAGCAGCCTTCCCATGTACTCTCGGTTCATGCTTCTACAATTCATGCCTAAATCGAGCAGAGCG
CATGACAAGGCGGCTCCACCGTCCATTCCGAAGCAAAGCGGCCGTCACAACAGCTCGGCACAGTCGTCGACAGTGCCACC
GCCCGCAATTCCAACAGATAGCTCGCGATTCAAGATCGCATTCTGCTCGCACTCTATGCTGGAGCTGCTCGGACTGGGAG
ACGCAGGCCAAGATGCGGTGCTGTACCATGACGTCTTTGACGTGCTCTTGGAACTTGCTGGTTCAAATTCTGTTACACCA
CTCTTCCGTGCGGCTGTGCAGCAACGGATTGCGGCTGCCGAGCCGGCCAGCCTGGAGCTGTCCATACCGGCGGGTGGAGC
ACCGGCGCCGGGCGCGGTCTCTGCTGGCCTCGGCGCTGGCCTTGCGTCGCCCACCGGCAGTCCTGTTGATGGAGAGGACA
GTCTGACAGATAGCACCTCGCGTCGGGCCAGGCTGTTCTCGTTCAGTCGATCCAAGAAACACAGCAGCGAGCGATCCGTC
AGCAACATTGCATTTGAACGCAGAGGACACGATTCAAGCAAGACCCAGAAGCTGATGAGCCACTGGACTCCACTCAAAGA
CGCCGATGGCAAAACTGCTTGGATTGCCCTTGTTATCTCTCCACTCATACCATCGTGAGCCAGGACGGATCTAGGTCCAT
GCTCCACACCCTCAGGACACTAGTCTCTTTTCACGGGTGTTTGCATATCTCTTTGCATTTATACGTCGGGATACCCTTGA
AACTTATGCGTCGTTCTATAGACTTTATTCAAACAAAGTTGCGCGAGTTAAGCCGGTCTAGGCGATGCTACCGTACTTGT
ATACCTGAGACGTAGACTAATAAACCAGGACGGGCTGGCTAAATTGCGCATCACGTGCGCCACATTACGCATACATACTA
AAACCGTATTGTTATCAGAGATACGGAGTAATTAATAGACAATTGCATAGCCGGAACGGGATGATCGTGAGTCCGACCCT
ACGCGACGTGAGTGCAATCCATCCGGTCTTCTTCCACACCAGCCGGCCACAAAGCGTTCGGAGGGCTACCTTTGGACAAT
TTGGACCTGGCCTTCTTCCAGTTGCTCGTTTTCTCATTTCCCATTTCCCTCGCCGTCTGCTCGAACGGCTCTCTGGTGGC
ACTCTCGCCGTAGGGGACGATGCCTCTTGGGCGTTTTCCAAGCGGGATCACCGATCTGACCAGCAGCCGCATCATCGGCT
GCCTCCACACCGAGTCTCTACCATCGCCGCGCCACGCGACGTCATGACGGACGCGAATCCCATCCTGCGCAGTCTGCTGG
GCTCGCTGACGACCATCGACCAGCGGCTGAGCTTTATCGAGACGGCCTTGCGCATTCCTCCGGCGCCGCGAGCCGGGCCA
AAGCTGCCGGCTGTCAGCAGCAGCGTCAGCGTCAGCGTCAGCGGTCGCGATCCCGACTGGAGCGCAGCCGGTCAGGTAGC
CGGTCGCCGGCCGCTTCCCACATCTGCGCCGTCGTTCTCGTCACTGTCACTGTCGTCCTCGTCGTCCTCGTCCGCCGCAT
CGCCGCCTTCATCGACACCCAAGCAGCAGGCCACGCAGGCACTTCTATCGACGAGCTTCAACCGGCTGAAGAGGCCGTCA
CGATCGCGATTGCAGAACAGACGGGTAGCCAAGTACGGAGGCGGCAGCGATGAGGAAGCGGCCGGTCAGAGAGATCTCGC
CAAGAAAGAAGAGGAGCCTGGCAAGAGAATCGACATGGACGGGGCGCACGAGGGAGACAGTCTTCAATGTGTTGTTGTTG
CTGCTGCTGCTGATGTTGTGTCCGACGGTGCCCTTCTCCCGCGGGAGCTGCGGCCGACCGAGGCCAGCCACAGCCGGCTC
GAGGCCCTGCCCGAGGGCTTTCTCGTCACCGGCCGGGCCTCGCTACAGGACGAGCTGGACGGCTGGACCATCCCGCGCGG
CTACAGCATGCGCATCAACGGCACGCGGTCGCACGGCCGGCGCCAAAAGATTCGCATGGTCTGCTTCCGCGGTGGCCGAT
CGCGGCTGCGACCCAAGGACGAAGACCGGGCGGTGATGGCGGCAACGACGGCAACGACGGCAGCCAGAGGGCCAGACGAT
GATATGACCAACGAGCACGACAACGAGGCCGACCAGGTCATGTCGATGATCGACGGCCCTGCGCATGGCCACGGCCACGC
ATACGCTCTCCCGTCGACGTCCCGACGGCGCCAGCGCAAGCCCACGACCGACCGCATCTCCAAGAAGTGCGAGTGTCCCT
TTCGGTTCGAGCTCGTCGAGATCGGCCCTGGCGCCGACCGCTACGCCGTCCACTACACCAACGACGATCACCGCCGCCAC
AACCACGCCGCCGCTGACCTGATGCTGGATCCGCGCGCCCGCAAGCTGCCGGCCGCGCTCAAGGACGAGGTCGACCAGTG
GCTGCGCGGTCCTGGCGGCAATGCCAGTGCCAGTGCCAGTGCCGACGGCAGCGACGGCCTCGACGGCCCCTGGTCCATTG
CTCGGATCCAGGCTGAACTGCAGCGACGTGGCTACGGTCACGTGCTCGACTTTGACCTGCGCAACCGCAAGCGCGCGCTG
CTGCACAAGGAACGCCTGGCGCAGCTCAAGACCGAAGGCGCCGCCAGCAGCGACAGCAACGCAAGCAGCAGTCCGACCGC
CGTCGCCGCCGTCGTCGCTGGAAACACGGCCGAAAACTCGTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62