GenePrediction:GLEAN_4016 Details

Name: GLEAN_4016
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2264918..2267287 (+ strand)
Length: 2370
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2264918..2265719 (+ strand)
Length: 802
Type: CDS
Source: GLEAN
Position: GCSC_113:2265784..2266119 (+ strand)
Length: 336
Type: CDS
Source: GLEAN
Position: GCSC_113:2266178..2267001 (+ strand)
Length: 824
Type: CDS
Source: GLEAN
Position: GCSC_113:2267068..2267174 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_113:2267239..2267287 (+ strand)
Length: 49
>GLEAN_4016 class=GenePrediction position=GCSC_113:2264918..2267287 (+ strand)
ATGCTGTTCCAGACCCTCGCCTGTGGCGCCCTTCTCGGCAGCGTCGCCCTGGAGGTGGCTGCCAGTCCAGTCGGCCAGCC
GCATGCATCCGTCGGGCTGTCCTCGGCCCAGAGCCAGCGCCGCAGCATCCCGGCCACACACGCTGTCCACGAACGCCAAC
TGCCGCACTGGTCCAAGATGTGGCGCCGCACGGATGCGGTTCCGCGCAACGCCATGCTGCCCATGCGTATCGGCCTCAAA
CAACGCAACATGCAGGAGGGACATGATCTGTTCATGTCCATCACAGACCCCAAGTCGGCCAACTACGGCCAGCACCTGAC
GGCCGACGAAGTTGTGGAGCTCTTTGCGCCCGAGCGGACCACCATCGACGCTGTGGTCGGCTGGCTGACCGGTTCCGGTA
TCGAAATCGGCCGTATCACGCTGTCGGCCAACAAGCAGTGGCTCCAGTTCGACGCGCCGGCCGCCGAGGTCGAGGATCTG
CTGCTGACTAAGTACTACGTCTTCGAGCACAGCGGATCGGCCACGCGTGACGTCGCGGCCGAACACTACCACCTGCCACA
CGAGATCCGGGACCATGTCGACTACATCACGCCGGGCATCCGCCTGCGGTGGGACAGCAAGAAGGCCGCGCGCGAGCAGC
AGAAGAAGCGCGACCTGCAGAGCATCGGGCGTCGTGGCACCTCCGGCAACTACCTGACCCCCGAGCCCATCCACAGCGCC
GATGCCGTTGCCGATGCCATCTACCCGGCTGCCTCTGGCAACGTGAGCTGCGCGCTCTACGTGACGCCGGACTGTGTAAA
AGGTACATTGAGAGGCAGGGCCGGAGAGGACAAAACGGGGACACGCAAGCTAACGCTGTTTTGCAGCCCAGTATCAAATT
CCCAACGCCACCAAGGCGGCTACGGGCAACGAGCTCGGCATCTTCGAGAGTCTGAACGAGCACTACAACAAGGCCGATCT
GGACGGGTACTTTGCGTCTGCCTATCCCTCTATTCCCAAGGGCACATACCCCATCGAACGGCTTATTGATGGAGCCGTGG
GGGCTGTCCCCTTTGGACAGGCCGGCGCCGAAGCCAACCTCGACTTGCAGGCAGCAATGCCTCTCATCTACCCGCAGAGC
ACCGTTTTATACCAGGTGGACGACGAGCGCATCCAGAAGAACGAGACGACGGCCAAGACGCCATATCTGGGCTTTTTGAA
CAGTAAGCCACCCAGATCCCGTCATGTCCAATTTGTAGCTGCTCCATCCTGACTCTCCAGCCTTCTTCGACGCCCTTGAC
GGCTCCTACTGCACATACAGCGCCTTTGGCGAGACAGGCAACTGTGTCACGCCTGAATGCCTGGACCCATCGTACCCCGA
CGCTGGACCGGGTGGTTACAACGGCACTCTGCAGTGCGGCGTGTTTGAGCCGACCAACGTGATCAGCATCAGCTATGGCG
GCGGCGAGATCGATCTGCCGGCATACTACTGGCGGCGCCAATGCTCCGAGATCATGAAGCTGGGCCTGCAGGGCGTCAGC
GTGGTCATCTCATCGGGCGACTACGGCGTGGCCTCGTATGTGGGCGACACCAACACCGTCGAGGGCTGTCTCGGTACCGG
TGGCCGCGCCGGCACCATCTTCAACCCATCCAGCGAGGCCACTTGTCCCTATGCGCTGGCCGTCGGCGCCACGTCGCTGA
ACCCGTCTACGGGCAACTACACCAGCCGACTGACCGAGCACGCCGCCCAGCGCTTTGCCTCTGGTGGTGGCTTCAGCAAC
TACTTTGACCAACCGGCGTACCAGAGCTCCGCTGTCGAGAACTACTTCAACACCGTGCAGCTCAACTTCACAGGCTACGA
CGACGCGCCCACCAGTCTTGCCGATATGGCCAACGTCGGCACCGGTGTTTTCCGCCGTGCTGGCCGTGGCTACCCGGATG
TGTCGGCCATCGGCGAGCACTACATCACCCGTTTCAACGGTGCATGGTATGCTATTGGCGGCACGTCGCTGGCGGCGCCA
CTGTGGGCCAGCATGCTAAACTTGGTCAACGAGGAGCGCATTGCCGCCGGCAAGAAGACTCTCGGTTTTATCAACCCTGT
GCTGGTATGTTTCTGTCCCCTTCTGTGCACCAGCGTGCTTCCTCTCCCTGGACCCGACTGACCGCCGCAGTACCAACACC
CCGAAGTGTTCAACGACATCACCGTCGGTAGCAACCCCGGCTGTGGCACTGAGGGTTTCCCGGCTGCAAAGGGCTGGGAC
CCAGTGACTGGTCTTGGGTAAGAACCATCTCTTGCCCCCTTACTGATTGTGTCTATGTTTGCATGACTAATGGCCACACA
GCTCGCCCAACTACCCAAAGCTGCTGAAGCTTCTGCTCAGTCTTCCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62