GenePrediction:GLEAN_4017 Details

Name: GLEAN_4017
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2283135..2284072 (+ strand)
Length: 938
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2283135..2283407 (+ strand)
Length: 273
Type: CDS
Source: GLEAN
Position: GCSC_113:2283488..2284072 (+ strand)
Length: 585
>GLEAN_4017 class=GenePrediction position=GCSC_113:2283135..2284072 (+ strand)
ATGGCCACCGTGGCTGGACTGGAAGCATTACTGGTAAATCTCGGCCTCGAGATGCCGGTGCCACGATTCCCAGCAGCAGA
CGTACTGGCTAAGCCAATTGATGTCTTCAGAGGCTACCTCGCCACCCTTCTGGGATCAATCCTCACTTTGGACGCGTCCG
CCATCTATGCGGCTATTGCCTCTACAAGTGACATATCGCTGGGCGATTTGGACGTTATAATCCCTCGCCTCCGACTAAGT
ATCGAAGACGTGCAGAGAGAGTTCAACTTGCATGTGCGTGAAAGTTACAAAATCTCACCTTTTGCTCAAGAAAAGAATAT
GGGCTAACAATCTAATTCCTCGCTGAGAAACAGAGGCCTGTATCTCCTCTCTTCCAAAGAATATTCGTTGAAGGTGTTCA
TATCCGCTGCTTCTTTTCGCTTCGCACCCTACCTGGCTTTTTACTTCCGTATATCAGAAATCGGGGTGCTTTGTACGGCC
AGGAGACACAGCTTGGGCTTAGAGATGTGACTGCTCCCGAGAAAGGCTACAACAAGGTGGTCGTCGAGTTTTCCTCTCCT
AATGTCCCGAGTGAGTTTAGTGACATGTACTTGCGCAGCACCATTCTTGGATCGTTCATCTCCAACCTGTACGAATCCAT
GGGCTGTGAAGTTGTTCGTTTGAACTATCTAGGCGACTGGGGCAAACAAATCGGACTGCTTGCCGTTGGCTGGCAGCGAT
ATGGGAAGGAGGATGCTTTGGCAGAAGACCCAGTCGGCCACCTCCTTGACATTAAAGCGCATATCGAGGAAGATTTCAGA
CCTGAGATAAAAGCGATTAAAGATGCCAAGGAGGCGAACCAGGATGCTCAAGCTTTGGAAGGCCAGGGAATTTTTGAGGA
ACGCGATGCCTATTTCAAAAAGATGGAAGACGGCGATGCAGATGCTGTGGCCCTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62