GenePrediction:GLEAN_4019 Details

Name: GLEAN_4019
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2304174..2308002 (+ strand)
Length: 3829
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2304174..2304522 (+ strand)
Length: 349
Type: CDS
Source: GLEAN
Position: GCSC_113:2304576..2304697 (+ strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_113:2304756..2304791 (+ strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_113:2304844..2306953 (+ strand)
Length: 2110
Type: CDS
Source: GLEAN
Position: GCSC_113:2307051..2307255 (+ strand)
Length: 205
Type: CDS
Source: GLEAN
Position: GCSC_113:2307315..2308002 (+ strand)
Length: 688
>GLEAN_4019 class=GenePrediction position=GCSC_113:2304174..2308002 (+ strand)
ATGCAACCTGGCTGCAGCTTGGACGCGCCGATTCCCGGCTTGTACGCTCAAACTACGACCACGACCGAGGCACACCGTCT
CACAGCTCTGGGCGAGACCGCCCCATTGTGTTGCCTGCCTGCATGCGGACATGCTATAAGACCAGGCTATCTGTCGTTTC
ATCTGGCTCTCGAGGTCTACACACTGGGATCAAGCCTAAGCGACACGTCTGAAAACCACGCCCTGCTCAACATGACTGTC
GATACCGTGCCCATTCCCGGCCCTGTTGGGCTGCCTGTCCTGGGCAATCTTCTGGACATTGATGCCGAGGTGCCGACGCA
GAGCTTTGCTCACCTTGCCGAACAATATGGTAGGATCTGCCATTCCAGTAGGTGCCATGTCTTGCCCTAACTCGCGTCAC
AGGCGAGATTTACCAAATGACCTTTCCGGGCAACAATGTGTTCAATGTTGTCTCCAGCCATGCGCTCGTCAACGAGTGCT
GTGACCAGAAGCGCTTTGGAAAGTCCCTTAGCAAGGCTTTAAGAGTACATACCCTGTCTCTTTTCAGATAAAGAAACATT
TCACGTTGCTAATGCTACACAGCAAGTTCGCAATGGTGTCCACGACGGCCTGTTCACGGTAAGCTATCGCTCTAGATCCC
TTATCTCGGACTCTGGCTAATCATCTCAAGGCCGAAAATGGCGAGCCCAACTGGGAGAAGGCGCACCGCGTGCTCACACC
TGCCTTTGGCCCCATGCCCATCCGACATATGTTTGACGAAATGCACGACATCGCCTCACAGCTGGCCCTGAAGTGGGCAC
GTCACGGCCCAGAAGAGGCGATCATGGTGCCAGAAGACTTTACCCGGCTCGCCTTGGACACGCTGGCGCTCTGCGCCATG
GGCTTCCGGTTCAACAGCTTCTACCGTACGGACATGCACCCTTTTGTCGAGGCCATGGGGTCGTACCTGACCGAGTCGGG
AAACCGCAGCCGCCGGCCACCACTGCCGGCGTTTGTGTACCGGGCGGTCGACCAGAAGTACTGGGCGGATATTGCGGTGA
TGCAGGACACGGCCGACGGGGTACTTCAGGCACGCAAGGAACAGAACCCGCCGTCCGACCGCAAGGACCTGATGGCGGCC
ATGCTGGAGGGCAAGGACCCGAAGACGGGCGAAAAGCTGGACGACAAGTCGATCATCAACAACCTGATCACTTTCCTGAT
CGCCGGCCACGAGACAACGTCGGGCATGCTGTCGTTTGCCTTTTACTACCTGCTGCGCAACCCAGAGACGCTAGAGAAGG
CACAGAAGGAGGTCGACGAAGTGATTGGTACCGGGCCTGTTCTACCCGAGCACATGCCGAAGCTGCGCTACATAGCGGCC
ATCCTGCGGGAGACGTTGCGTATCAGTGCGACGATCCCGGCGATCATGGTGGCACCGCACAAGGACGAGCTAATCGGCGG
CAAGTACTTTGTCAAGGCAGGCCAGAACGTGCTGCTGCTGTTTATGAAGTCGCACCTGGACCCGGCGGTGTATGGCGAGG
ACGCCAAGGAGTTCAAGCCCGAGCGCATGACGGACGAGAACTTTGACCGACTCAACCGCGAGTTCCCCAACTGTTGGAAG
CCGTTTGGCAACGGGGTGCGGGCCTGCATCGGCCGGCCGTTTGCGTGGCAGGAGAGCCTGATCACCATGGCGATACTGCT
GCAGAACTTCACATTCCGCCTGGACGACCCCGACTACGAGTTGACCATCAAGGAGACGATGACGTTTAAGCCCAAGGACT
TTTTCATACGAGCACAACTGCGCGATGGCCTGACACCGACGATCATGGAGCACCGGCTGGCCGGTGGCCGAAGCCAGACC
GAGATGGCAACAGCAGCAGCAGCCACAGCAGCCGAGACCACATCGAATGGCGTCAAGAGCAGCGGCACGGCCAAGGGGCT
CCCTCTGAACATCTACTACGGGTCCAACAGCGGGACGTGCGAGGCCATGGCAGATCGGCTGGCGGCCGACGCACAGGCAC
ACGGGTTCCGTGCCGAAGTGGTGAAGCCGCTGGACGCGGCCAAAGAGGCACTCCCGACGGACCGACCGGTGGTGTTCGTG
ACGGCGTCGTACGAGGGCGAGCCACCGGACAATGCTGTCTCGTTTGTTAGCTGGCTGAAGGAAGAGACGGAGGGAGAGGC
AGCAGGCGACGCGCTCAAGGGCGTTGCCTATGCCGTGTTTGGCTGCGGCAACCACGACTGGTCGCGGACGTTCCACCTCA
TCCCCAAGCTGGTGGACGAGAAGCTCGAGGTGAAGGGAGGGGCACGCATTGCACCGATCGGCCTGACGGACGTGGCCGAG
GGCAACATGTTCGAGGACTTTGAGGCGTGGGAGGACAACGTGCTGTTCCCGGCGCTGCAGGAGCGGTACGGAGTGGCTGC
GGCGAACGGCGACGAGACGGCCGAGGCAGCGGAGGCAGCAGTGCTGGATGTGGAGATCACGATGCCGCGGGCGTCAGCGC
TGCGACAGGATGTGCGCGAGGCACAGGTGGTAGCAACGAGGGTGCTGGTAGACGGCGACGAGAAGGAGGCGGCAGAATCA
CGCAGGAAGAACCACATTGAGATTGAGCTGCCGAGCGGGATGACATACCGGGCGGGCGACTATCTGGCGGTGCTGCCATT
TAACAGCCAGACGACGATCAGACGGGCGATGCGACGCTTCCAGCTGCCGTGGGACGCCAACATTGCGGTGCACTCGGGCG
AGAACGGAGCGGTGCCATCGACACAGATCAGTCCCTACCGGCCGACCGGCCGACACCGGCGTACGGGATCCTGGGAGCAT
ACTACGAGCTGGGACAGCAGGCGACAAAGCGGGTGAGTGGAAGATGTGTGTTTTTGTATTCGTCGTGTACTAACAAGAGC
CACAGGGCATCACGGTGCTGGCCAACGCGGCCACGAAGGCAGAGACCAAGGCCGAATTGCAGCGTCTAGCTAGCGACGAC
TATGCAGCAGACATCAGCGCTAAGCGGGTCTCCATTCTCGACCTGCTGGAACGGTTCCTAGACGTCGACCTGCCGTTTGG
CACTTTCCTGTCACTGCTGCCGCCAATGCGAGTGCGCCAATAGTAAGATAGCCCCATCGTTTGATTTTCTTTTGAAGAAG
GGAACACGCTGACACAGACAGCTCCATCTCGTCTTCGCCGCTGTGGAATGCGAGCCGAGTATCGCTGACGTACTCGGTGC
TGGCCCAGCCGGCACTGTCGGGCAAGGGCGTGTATGAAGGCGTGGCGTCCAACTACCTCTCGCGGACGACGACAAACGAC
ACGATTCACGTTGCGGTGCGGCCGAGCCACAGTGCGTTCCACCTTCCGGAGGACGTGGAGAAGGTGGGCGTGATCATGGT
GGCAGCAGGCGCAGGTCTGGCGCCATTCCGCGGCTTCATCCAGGAGCGGGCAGAGCTGAAGAGCGCAGGGCGGCAACTGG
CGCCAGCGATGCTGTTCTTCGGCTGCCGCAGTCCGGCCGAGGACCTCTACCGCGACGAGCTGGACGACTGGGAGGCCAGA
GGCGTTGTCGACGTGCGACGAGCCTACAGCCGGGCACCAGAGGACACGAACAACGCAGTGGCTGCGAAATGCCGTCACGT
GCAACACCGGCTGTATCATGACCGCGCCGACGTGCTGGAGCTGTGGAAGAGCGGCAGCCAGATGTATGTGTGCGGTTCGC
GGCACGTGGGCGCTGGTGTGAAGGAGTCGGTGATGCGCATTCACAGCGAGACGAAGGCGGCCGAAGGTGCAGCTGAGACA
GAGGCGGAGACGGAGGCGTGGTTTGACAGCATGCGCAGTGTGAGGTATGCCGTAGATGTGTTTGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62