GenePrediction:GLEAN_401 Details

Name: GLEAN_401
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1552852..1553889 (+ strand)
Length: 1038
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1552852..1553035 (+ strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_167:1553132..1553889 (+ strand)
Length: 758
>GLEAN_401 class=GenePrediction position=GCSC_167:1552852..1553889 (+ strand)
ATGCGATGCTGCCGCGCACATGGTCGCGTAGCCGGAAGCGCAGTCCCGTCCCTCTTGTGTCGAGATGTCACCGGCCGCAG
TGTCCCGTCTCTGTTTCGCACCTCAGCAAAGAGAGCAACAGCCAGATACGGTGGCCTCTACCTGGCCTCAGCCCAGGCCA
AGAAGACTCGTGCTGACCTATGGCGTGAGACCTCCAAGTCCAATTGGCTGCATGTTTGGCTGCACGCTGGGAAATGCAGA
CCGTATCTGACATTTTATGGTGCCCGTTTTTTGTTTACAGCTCGCTCGATTGGCTCTTGTCGCCTGTTTACGTCCTCGAC
AGCCGCGACCCCATTCCCGGCCAAGGCTGCCGGAGAGGAGCGTTCCATCCGTGCAGGGGTCGAGGGAGCCCCACCATCGC
TGCCCGAAGACCTGCGCCTGCTGCTGCGCCATCTGGCGAGCTCGGTGGTGGTCTGCACGGCGCTTGCCGGCGCTGGCGAT
GCGCAGCAGCAGGACGACCGGCCGTCTGGCCTCCCCGTCGGCCTTACAATGTCCTCCTTCACCTCGCTGAGCCTCTACCC
GAGCCCGGTGGTGTCCTTCAACGTCGCCATGCCCAGCCGGACCGAAGCTGCCATCGCGCAGACGAGACACTTTATGATCC
ACATCCTCTCGGGCGATGCCAGCGGCGCACGTGTCGCCGACGTCTTCCGCTCCGGAAACGCACACCCCGAGAGTACGGCC
CGGGCGTTGGAAGCCTCCGACTGCCGCCTGGTCTGGCCCCCGGAGTCGCTAGACCCGTCTTCCCCAGCCGGTCAGCCCTT
CCTCTGCGGGCCGGGCGTGCTCTTCGTGCTGCGCTGCCGCCTGCTCGACGAACCGCTGCGAGGGCTTGTGCCGGTCCGGG
ACCACGTAATCGTGCTGGGCGAGGTGCTGGAGATCATACAAGGCGGCGCAGATCACGTCGACAGCAACGGCATCCCACGG
GTCGGCTTGGCCTATGCCAACAGGCAGTACTGCCAGCTTCCGGGCGCAAACATCCCGGCAGAGGAAACAGACAGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62