GenePrediction:GLEAN_4020 Details

Name: GLEAN_4020
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2312196..2314071 (+ strand)
Length: 1876
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2312196..2312237 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_113:2312558..2312647 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_113:2312689..2312952 (+ strand)
Length: 264
Type: CDS
Source: GLEAN
Position: GCSC_113:2313005..2313326 (+ strand)
Length: 322
Type: CDS
Source: GLEAN
Position: GCSC_113:2313408..2313775 (+ strand)
Length: 368
Type: CDS
Source: GLEAN
Position: GCSC_113:2313841..2314071 (+ strand)
Length: 231
>GLEAN_4020 class=GenePrediction position=GCSC_113:2312196..2314071 (+ strand)
ATGTCAGGCGACAAGACGACACGTCAGCCCAAGGCGACAATTGTCGACATTGCATCGCGTCTGATCCAGCTGTAGCGGAC
CCTCGTGGCCGTATCGGGAGGTGTTGGCGATGCCGATGGCAGCAGTGAGAGCGCTCCGGGAGCTGAGGCGGCAGTACTGC
CATCGCTCGAGCAGACTCTGTCCGGCAGCCAGTCTCAGCCACTGATAGAAAACGAGGACGCAGGATCTATAGCCTCGGAA
GATATTCCGATCAAGAACTCGTTTCGATACATCAATGAAATCTAGCTGTCGCGGGTGCTCGAAGAGGTGCGTTGCTGACG
GGAACGAGACATTGTTGTGTTAAGCCATGGCCATTCTTCCAGGAGCAAGAGATCCAATCGATTCTCGCATCACTCAAGGA
TCCAGACGCCGGAGACGACAGAAGGGACGACGACTTCCCGGCCCACGGACTGGTGCCGACATTCGACCTCTTCTGGTCGC
CTGACCGCAACAGGCCGCTGGGGTGGACCGGTTTCAGGCTGGACTGGAGTACTCGTTGGCACGGTCCAACTTCCTGGACG
CGCCTACGGTGTACGGACTGCAGGCACTGACACTGTTTCTGCGGCTGACGCGGGCACGGTCGCCGGGACGGTCGGCATGG
ATTATGCACGGAACGGTGCTGCAGGCGGCACAGTCGATCGACTTCCACCGTGACGGGGACAACTTTGGGCTGTCGCCATT
CGAGTCGGAGATGCACACTGCCGGTCTGCATGTACCGGTGCGAGCTTGTGCGGTATCACACGGCCAACGTGGAGGCGCTG
CTGCTGTAGTGCAACCCGGCGGTGCCGCTGCCACGGCTGACGATCCAGATGGTGCGCATGGTGCAGCTGAAGAACAGCCT
GGTCAGCCAGCTGCAGCTGCTGACGGCGACGAGAACCAAGGCGACCGGCCGCAGTCAGGTGCCACGCGCGACCGCGGTGT
CGCTACTGGGTGCCTGCCAGATCATCGAGCTCAGCCCAGACATCCAGGCGGACGAGCTGCTGCAACACATGCGCTGGGCT
AGCGATATCTACCCGCAGTACCACGTGCTGCTGCACCTGGTCTGTCACCTCTGCGAAGGCGATGCGGATCCGCGAGGCGA
CGCAGAAGGGGGTAGGTGGTGGTGATGGCAGTGCTAGCTCTGACAATACGACTGCTACGAATACTGATGAGACCGGCGCT
CCTTCATCACAGACGGCACCTCCGGCCTTTCTGCCAGACGTAGAAATGACGCCTCTTTGGAGACAGCACAAGAGAGGAGA
CGACCACGAATTGGGACAACGACTACTTGGGAGGCCGGTGCGGAAGCCGATCTCCTTTGGCGGCGAAATCTGGGCGACGA
GCGAGGCGATGAGGCTGACGTACGCGCCAAAGAAAAAGTCGAAGAGGACGGAAAAGGCGATACTGGCTGGCTGGCTGTTG
CCGGGGATCCAGAGGGCGAGGATGACGATGCCGGTGACGGTTTAGGAGACGATAAAGGCGTTGTACTTGCCAGTCTTGTC
GGCGGCTCAGCCGGAGAGCAAACGGCCGACGAGGCTGCCGGCATTGAGGATGGCCAGCAGGTACTGCACACGCCCTCCGA
TAGCAGCAGTTGGTAGTACTTGGTCGCGAGCGAGGCCATCATAAGCCCAAAGACGTGCAGCAGCGTGCCGACGAGGAGGA
TCTGGCGCGGGCCATACGAGTCGAAGAGCTTGCCGACAACAGAATCCTGGACAAGTCAGTATTCAGAGAATACAACAGAC
AGGAGCAGGCGAGTAGTCGAAAGCAGACGAGCAACATCCAACACCTCATACGCACCATAGTCATCATGAAAAAGATCTGC
AGCGACGGAATCCACACAATCGTGCTGGTCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62