GenePrediction:GLEAN_4021 Details

Name: GLEAN_4021
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2315790..2317792 (+ strand)
Length: 2003
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2315790..2316039 (+ strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_113:2316975..2317792 (+ strand)
Length: 818
>GLEAN_4021 class=GenePrediction position=GCSC_113:2315790..2317792 (+ strand)
ATGGCCTCACCAAGATGTAGTGCGCGCGGCCACTACGACGAGTGCGAATTTCACCACAACTTCTACAACCCGCGCGAAGG
CTGCGTGCGGTGCAAGGGCGAGGTCAAGCGGGCCGAACAGCAGGAGGGAGCAGCCCAGCGAGAGCTGGCCGAAAGCGAGC
GACAGGCCAGGGAGGCGAGCGAGGCAGCAAAAGCGGCGGCGGCGTCAAGCCGAAAGCAGGCGAGCCACGCGGTGCCGACC
CAGACTACGAGTACGAGTAGGAGTAGTGGACGAGCAGCAGAGGAAAAGAAAGCCAAGTAGCTTGTCAGGCAGCAAGGTGG
TGTTTGCCTTTGCCCAAATGAGCATCACGTGGGCCTTGGCGAACGGGAGGAGCAAGACAGGCCGGCCTGCCATTGCTCCA
TGCTGCATCCCGTTTCGACAGAGATGGGCCCAGCCGCCTCGGTTGGCGTTTACGAGTACGAACAAAGTCTAGAGATGGCG
GTTTGCGGCTTCACAGCCTGACGAACAATGGTGTAATAGGCGTCTGATGTTTCGTTTTGTCTGACTGTTTGTGCAGCTGT
TTTTTAAATCATCCGCGAGAGCTCGAATGCACTGAAATTTTCCACCAACACTGTTATGCGTCCCGTGATATCGAAACAGC
TCATAGGATGACGATCCCCATTAAAGACGTCGAAGGAGAGCCAATCGGCGACGCAGCCGCAGTGTCCTAGATGCAAAAGC
AGGTGACGATTTGTCTTGATCGTGTGTTCTCATTCTGCTGCGTTGCAGCGAGCATGAGCTTCCCCGGCGGAAACCCGCCC
CGGCCTTCTTCGCTTGCGGTTGCTAAGATGAGCAACGGCCCAAGGGATCGAGATGCTGAAATTGGCTGACAGACGAAAAT
GCGGAGAAGCAGCGCTGTGGAGCCGAACGGAGCCCGGGAAGACAACCTTACTGGGCAGGCGCTGACTAAAACCCAATGGC
GACCCATTCATTGCAGAGAAAAGTTGGGGGGAGCTAGCCATGTTGCCCCGCCTTGATGGGTCAGGCTGTGCGCTCCAGTG
GGCGCAGCTGCTGTAATAAATTGTTTGCCGCCGCGTTCCGGGATTGGCCGAGGCTGTATGTGTGCCCTGTGCCCTTTCTA
GATAATATCTTCCACTCGTCCACCAAGAAATCGACTGCCCGGCCGCGGTGACGACACACCCACAGGGCCAACCCGCACCG
AGCTCTCTCTCCAGCCGAGCGATACTTTGGTCTGCAGCTTCTGCATTCCCGACGACAAACCACACCTGACCTTCGACACG
AAATCCCGACACGAAGAACAGCGACGCGCATCCGAGACAGCGCCTAAGACGCAAAGCGGCGAACCGACGGCCGGCCACAT
GTCCCCGGTCCACTCCGGTCACACCAGCACGATGCCGTCGCAGCGCCCCTTTTTCCTGTCGGCCTTTTTCGCCGCCTTCC
GCCAGCAGCCCAGCTCGTCGCCGCTATCGACCTCCACGGCCGCAGCCCAGCAGGCGAACCGTCACAGCTCCACGGCCACC
GGCAGCGCCTCGGTCGATCCGGCATCCGTGTCGTCTGCGGCTGCGGCTGCCGTGGCTGCCTCGCACCGGCTGCACGCGAC
GCGCTCGCACAGCAGCACCGGCGGCAGTGGTGGCGGCAACGGGAGCAGCTGCAGTGCTGTCAGCAGCGGTGTCGCCAGTG
CCAGCGGAGGCATTCCTATCGCGGCCGGTGGAGCACACGCGGCCGGTGGCCAGGCTACGACGTCGAGCACCAGCGGCAGC
AATGGCAGCTATGGATACTACGGCAGCGACGAGGCATACTACGGCGTGGCGTCTCCCCATCGCCAGAGTGGACGACGACG
CGGCAGCGACAGCAGCAGCGAGGGCTTTCGCGACGTCATGGGCGCCGACAAGTGGTACATTGGCGGCCGGACAGCCGCCG
GCGAGGAGCGCTTCTTCAAGCTGGGCGTCGTGCGCCGAGTGCGCAGCGGCGACCGGCTGAGCCTCGACCGGCTGAGCCTA
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62