GenePrediction:GLEAN_4026 Details

Name: GLEAN_4026
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2338259..2339701 (+ strand)
Length: 1443
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2338259..2338429 (+ strand)
Length: 171
Type: CDS
Source: GLEAN
Position: GCSC_113:2338572..2338794 (+ strand)
Length: 223
Type: CDS
Source: GLEAN
Position: GCSC_113:2338876..2339016 (+ strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_113:2339151..2339268 (+ strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_113:2339330..2339398 (+ strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_113:2339453..2339479 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_113:2339542..2339701 (+ strand)
Length: 160
>GLEAN_4026 class=GenePrediction position=GCSC_113:2338259..2339701 (+ strand)
ATGCCCGATTCTGATGCTGCCTTTGCGGCAGAGAGCGGCTTGCCGAGGATTCTGGGACTTCTGACCACGTTTTTCTTCGT
TTCCGTCATCGTTGTCGGCCTTCGCATGTACACCCGAATACGCATCCTTCGCACTGCTAGTTCCGACGATGTCCTCATCG
GCTTGGCAGCAGTACGTCGATTCTACTCCTTCCTTCCTCTCTTGCTTGTGCTGCGGCACAAATAGCTGATGTCTTTTCGG
TTTTTTTCTCCCCACATTTGAGAAGTCAAACTAAATCAAGACTCTCTGCCCTCCCCTTGCTAAGCTTTGCCAGCTGGCAG
GATGGATCATGGTTCTCATCCAGTCAAAATACGGCCTTGGCCGCCACCAGTCAACCATCTCGGCCGACGACTTGAAAATA
TATAATAAGCTATTCTTCTGTCTGAATGTCGTTTCAATCGCCATCGGAACCATGTTCCTCAAGGTTTCCATTGCCCTCAA
CCTTCACAGACTATGCAAGAACCAGTGGTATAAGTGGTCCTTGCGCGTTCTGATAGGTGAGCCTATATGCTTTGTCTCCA
AGATTCAAACAAACAATCTTGCGTGCCTGGCACACTGACGCATTGCGACGCCTATAGTCATCGTCATACTTTACGAATTT
GTCGGCTTTCTCTTCTTCTTCCTCGACTGCAAACCATTGGCTGGCTACTGGGACACGACCCTAGATGCCAAATGCGCAGA
GACTAGTACGCTTATTGCATTTGGTCTGGTCAACACAAGTTAGTTATTTTTAATACTCTTTTCCCAAGCTTTTTTCCCCA
TCCGAAAATAAGCAAAAGGCTCAACCAAAAAAATCTGGGAGGCCAAGGGGGCTGCGATTGAATAAGTTAACAATAAGTTT
GAAACGCAACAGGCTTTAGTATTGTCACCGATGTTGCGCTCGCAGTTCTTCCAATTCCTATCATCTGGGCTTTGAACATG
AAGCTGAAGCTCCGCTTGTACCTCATTGCAGTCCTTAGTCTTGGCTATCTGTAAGAAATGCCGGCTTATTACTTTCCAGT
GCAAAATCCGTTGACCAACCTTGTCGCCTAGCGCTGTGGCAATGGATATCGTCAAGACTTATTACCAAGAAACCTTCTCT
TTAGACGTGGACGAGACCTAGTATGCTTGTTCGCCCTCACACACTTCTTCTCTGATTCTGACACTTGCTCACAGTACCGA
TAACCTCATTTTGTTTGGCCTGTATGTTTGATATTTTCCCATTTTAAGCATAGTATCGTACTAACTCTTCCCTACCCAAA
CAGCCTTGAAGAGTATTTTGGCATGATTGCAGCCTCTGTGCCGATGCTTAGGCCATTGGTCGGCAAGGCCATAGGTCTCT
CTTCCGCAGATTACTACACCTACGGCCGCAATACTGGCGATACAAGCTCGATGAGCGCGAGACAAGCAGCGAGGGTGGCT
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62