GenePrediction:GLEAN_4028 Details

Name: GLEAN_4028
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2347104..2348629 (+ strand)
Length: 1526
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2347104..2347236 (+ strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_113:2347335..2347470 (+ strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_113:2347528..2348629 (+ strand)
Length: 1102
>GLEAN_4028 class=GenePrediction position=GCSC_113:2347104..2348629 (+ strand)
ATGTCCCTTCGTGCAATCGTCCGTCTCAAGAAGTCACAGAGGACATCTGTCGAATTGCACTTCAGATTCCCACTTCGTTC
CGGTCTAGCATCAGCTTCGAGCTTTGGCTCCCACGCAAATGGGACGGCCGACGGTACTTAGCAACGGGTAATGGGGGAAT
CGACGGCTGTGTGTGAACCTCCATGTTCTTAAACAAGTTGTTTGTTCTAATACAAGCTCACAATTGACTAGGCATTAAGT
ATGAAGATCTGGCTTACGGCACAGATCATGGCTTTGCGACCATGGGAACAAATAATGGCCACAACGGCACAACCGGGATC
ACGATGCTCAACAATCCGGATATTGTGAAAGACTACTCTTACAGATCGTACGTAGTTTTGAATAAAAAAAGTGGCATTGG
ATAAGAGCTGACTGTTGAACACAGGCTTCACACCGGCACCAAAGTAGCCACCAAACTTATCAAACATTTCTACAAGAAAG
CGCCTCTACGCAGTTACTATCTTGGGTGCTCTCTCGGAGGCCGCATGGGTATCAAAGCAGCCGAGGCTTTCCCAAACGAC
TACGACGGTATTGTTGCAGGATGTCCTGCCGTCGACTTCAACCATCTTCAGGGCGAGAGAGCAATGTTTTACCCTATCAC
GGGAAACTCGAGCTCGAAAAACTATATCAATATTGAAACGTGGACTGGCCTGATTCACAACGAGGTGCTCAATCAATGCG
ATGGTATCGATGGCGTTATAGATGGCATTATCGAGGTTCCGGACAAGTGTTACTTCAACCCAAGCACCCTGCTTTGCAAC
AGTACACAGACGGAGAACTGCCTCAATGTCAACCAAGTTCAGCAATTGGAAAAGATATATGCGCCTTACACTTATCCGAA
TGGCAGCCTCATATTTCCGCGGATGAATCCTGGTAACGAACTACAGGCCGTTGCCAAACTCCTCGCTGGCACACCCTTCA
GCTACTCAAAGGACTGGTTTCGCTACGTTGTCTATAGTGACCCGAACTGGGATCCTAGCACCTACAATGCAGATGACGTC
CAGATTGCAGATGATCTCAATCCGTCCAATATTCGCACCTACCCGCAAACTCTTCCCGAATTCAGGGGCCGTGGAGGAAA
GATGATCAGTTTCCATGGAGGCCAAGACAATCAGATTACACAATTCAACACTAGACGTTTTTGGGACCGCATGGCCGAGG
TTGACGATGCGTTGCAAGACTACTACCGATTCTTCCGCATATCCGGGATGTTCCACTGCAATACTGGACCTGGTGCTTGG
GCTGTGGGCCAAGGTGGGGGCTCCTCTGCCAAAGGTGTTCCTTATGAGCCCGAGTACAACGTGCTGGCTGCCATTGTAGC
TTGGGTTGAGAACGGGACCGCACCGCAGAGTCTGACCGGGACTAAGTTTGTCAACGACAGCTTCGCCGAAGGGATCGACT
TCCAGCGTACGCACTGCCTGTATCCCAAGTCGCAAACTTACCTCGGCGGAGACTCTAAGCTGCCTTCGAATTGGCAATGC
CAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62