GenePrediction:GLEAN_4029 Details

Name: GLEAN_4029
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2352541..2353607 (+ strand)
Length: 1067
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2352541..2352590 (+ strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_113:2352818..2353321 (+ strand)
Length: 504
Type: CDS
Source: GLEAN
Position: GCSC_113:2353598..2353607 (+ strand)
Length: 10
>GLEAN_4029 class=GenePrediction position=GCSC_113:2352541..2353607 (+ strand)
ATGAGGATCATGGAGCCGTGTAGGCTGCCGCTCGGGTTAGACGGTTCCAGGTAACTGAAAACACCAAGAGTGGGCTTGTA
GGCATGGGACTTGGCGATTTTTGTTTTTCCAGCGGGGGGGTTTGGCGGGCCGTCATTAATAAAAACGGTTGGTATCTCCT
GAAAACTCATGTCATTGGAGAATTTGACATCAGAGTCTTCCGTTGAAGGGCTGTCGGTTCTCGAAGATCGGCGTAATGGC
AATACCCAGGCGGTCTCCTTATATGACGGAGGGTCAGCTTCCGCACGCTGCTGTGGGAGCTGTCGCAAGACGACTTGGCC
GCACAGTCGCAACACAGCATCCTCTTTTATACCGGGCTGGCCTTTCAGCACGAGGCCCGGCCGTTCTACATCAAGATCAA
GATCCAGGGCCGCTTGCGCAAGGTAACAGACCAGATCAAAAGCATCTTCCCGCCTCGGGCTAAGCCCAAGCAGGGTACAG
CGCTCATGCTTATTGGAATTGACTCGAGCTACAACTCCGGCGATCCCCTGGACTCGTTCGCACGTGGCCTAAAGGAGGAT
ATGTTAAGAAAGAACCGGGAAGCAGTATCCCGTCGGGTTCCAACCACAGGCCTTCAAAATCTGCCACCGCCCCCGTACGA
GAGAGACGAGATAATGCAAGCTCAGGAGGCGGCCATGACAAAGACAGCAGAAGAGCTTGAGGCCGGTAGGGGCCGTGCCG
CCTCCATCGTCGAGAAGCTGGCGCTTGCGCCGGAAGTCTACTCGTCAAAGGATGCGAGCGGGTGTAAAAGCGACGCGAGA
AGCAGCGCCTCCCGGACGTCATCAGTATCGGGCACGACATGCAAAAGCACAGCGATAAAAGAACTGCCACTGCAAAGACA
CAAAAAAGCAAGAGAGCGGGAGACGGAAGAGGAGAGTATACGGCGCGCTGTAGCCCTTGTCTGGTACCAACTCTTAGCCC
TTTTCTATACCGTATTTATACAAGCAAAGAGAAGACGGAACTAGGCAAAGCAAAGAAATAGCGAGTTATACTAAGGACCG
CGTATAGCGTCTTATAGATTTGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62