GenePrediction:GLEAN_402 Details

Name: GLEAN_402
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1554892..1557080 (+ strand)
Length: 2189
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1554892..1555152 (+ strand)
Length: 261
Type: CDS
Source: GLEAN
Position: GCSC_167:1555221..1557080 (+ strand)
Length: 1860
>GLEAN_402 class=GenePrediction position=GCSC_167:1554892..1557080 (+ strand)
ATGTCTGGAGAGACTTTCGAGTTCCAGGCTGAGATTTCTCAGCTGCTTTCTCTCATTATCAACACTGTCTACTCGAACAA
GGAGATCTTCCTCCGCGAGCTTGTGTCCAATGCCTCTGATGCTCTGGATAAGATTCGGTACGAGTCGTTGTCCGACCCCA
GCAAGCTTGACTCAGGCAAGGATCTCCGGATCGACATTATCCCTGATCAGGATGCCAAGACCCTCACTATCCGTGATACC
GGTATCGGTATGACTAAGGCGGTATGTCTAAACCATAAACCACCTTACACCACGATGTACCATTTGGGCCAAAACTAACA
AGCGTTCAGGATCTCGTCAACAACCTGGGTACTATTGCTCGGTCTGGTACCAAGCAGTTTATGGAGGCCCTCACAGCTGG
TGCCGATATCTCCATGATTGGCCAGTTCGGTGTCGGTTTCTACTCTGCATACCTGGTGGCCGACCAGGTCAAGGTCATCT
CCAAGAACAACGATGACGAGCAGTACGTCTGGGAGTCCAGCGCCGGTGGCACTTTCACCATCGCCACCGACACTGAGGGC
GAGCCCCTCGGTCGGGGTACCAAGATCATCCTCCACCTGAAGGATGAGCAGATGGAGTACCTCAACGAGTCCAAGATCAA
GGAGGTCATCAAGAAGCACTCCGAGTTCATCTCCTACCCGATCTACCTTCACGTCAAGAAGGAGACCGAGAAGGAGATTC
CCGATGAGGATGCTGTCGAGGAGGAGACCACCGAGGAGTCGGACGACAAAAAGCCCAAGATCGAGGAGGTCAGCGATGAT
GAGGATGGCAAGGAGAAGGAGAAGAAGCCCAAGACCAAGAAGGTCAAGGAGACCACAATCGAGGAGGAGGAGCTCAACAA
GCAGAAGCCCATCTGGACGCGCAACCCCCAAGACATCACCCAGGAGGAGTACGCTGCCTTCTACAAGTCGCTCACCAACG
ATTGGGAGGATCACCTGGCTGTCAAGCACTTCTCTGTTGAGGGTCAGCTCGAGTTCCGCGCCGTTCTGTTCGTTCCCAAA
CGTGCTCCCTTTGACCTGTTCGAGACCAAGAAGACCAAGAACAACATCAAGCTGTACGTGCGCCGTGTCTTCATCACCGA
CGACGCCACCGACCTGGTGCCGGAGTGGCTTAGCTTCGTCAAGGGTGTTGTTGACTCTGAGGATCTCCCTCTGAACCTGT
CGCGTGAGATTCTCCAGCAGAACAAGATCATGAAGGTCATCAAGAAGAACATTGTCAAGAAGTCGATTGAACTCTTCAAC
GAGATCGCCGAGGACAAGGAGCAGTTCGACAAGTTCTACGCTGCCTTCTCCAAGAACCTCAAGCTGGGCATCCACGAGGA
CTCCCAGAACCGCCCGGCTCTGGCCAAACTCCTGCGTTTCAACTCGACCAAGTCTGGCGATGAGCTGACGTCTCTGTCTG
ACTACATCACGCGCATGCCTGAGCACCAGAAGAACATCTACTACATTACTGGCGAGTCGATCAAGGCTGTCACGCGTTCT
CCCTTCCTGGACTCCCTCAAGGAGAAGGGCTTCGAGGTGCTGTTCCTCGTCGACCCCATTGACGAGTACGCCATGACTCA
GCTCAAGGAGTTTGAGAGCAAGAAGTTGGTTGACATCACCAAGGACTTCGACCTCGAGGAGACCGAGGAGGAGAAGACGT
CCCGCGAGGCCGAGGAGAAGGAGTACGAGGGCCTTGCCAAGGCGCTCAAGAACATTCTCGGCGACAAGGTCGAGAAGGTT
GTCGTCTCCCACAAGCTGGTTGGCGCACCCTGTGCCATCCGCACCGGCCAGTTCGGCTGGTCTGCCAACATGGAGCGTAT
CATGAAGGCTCAGGCTCTCCGTGACACGTCCATGTCGAGCTACATGTCGTCCAAGAAGACGTTTGAGATCTCGCCCAAGA
ACTCCATCATCAAGGAGCTCAAGAAGAAGGTTGAGACTGACGGCGAGGACGACAAGACGGTCAAGTCCATCGTGCAGCTG
CTCTTTGAGACCTCGCTGCTGGTTTCGGGCTTCACCATTGACGAGCCTGCCAGCTTCTCCGAGCGCATCCACAAGCTGGT
GTCCCTCGGCCTGAACATCGACGAGGAGCCGGAAACCGAGGCCGCTCCGACCGACGCTGGCGCGTCTGCTGCCGAGACTG
GCGACAGCGCTATGGAGGAGGTGGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62