GenePrediction:GLEAN_4030 Details

Name: GLEAN_4030
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2355897..2358188 (+ strand)
Length: 2292
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2355897..2356178 (+ strand)
Length: 282
Type: CDS
Source: GLEAN
Position: GCSC_113:2356250..2356372 (+ strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_113:2356612..2356826 (+ strand)
Length: 215
Type: CDS
Source: GLEAN
Position: GCSC_113:2357261..2358188 (+ strand)
Length: 928
>GLEAN_4030 class=GenePrediction position=GCSC_113:2355897..2358188 (+ strand)
ATGTATGCCCCAAGCCGTGTCATGAACTTTGCCGGGATACGTGGCCTGCCGAATGCCGACTGGTGCGAGGACCACAAGGT
TGAGACTGCGCGATCAAACATCCTGGGTGTGATGAACCTGGTCGATTGTTGCTTTCTTCTTGGCATACACATCACTCAGT
TCGGGTCAGCTTGCATCTATGAACACGACCTTGATCACCCAGTCGACACCCAATTTAATGAAAAAGACGAGCCCTTTTAC
GCTGGCTCCTTCTACTCGTTTACCAGACTGATTAGCGAAAATGTATGTCTTAGCCGGACAGCGATATTTTTTCATGTTTA
CTCATAACTAATCTCAAAACATTTCAACTGCAGGCCATCAAGCACTATCCAAATCTTCTCCTTCTTCGTGTCCGAGCACC
AATCGCTGCAAACCTGGATCCAAATAACCTTCTTACCAAACTTTTGGAGTATAAGAAGATTTTGAACATACAAGCGGTAG
GCTTACAACGAGCAATTTCAAACTACTTAGTACATGTCTAATGCATCCTACAACTCGTAGTCTGGTACCATACTGCCCGA
CTTGTTGCCCGGAGCTATATTGCTTTCCGAAAATCTTGAGACCGGTATATATAATTTAGTATGTCTGTTTTTTAAGAAGT
TCTCTCGAAAACTATTATCGGTGTTATTTTCTTAGGAAATGTTGCCGAGAGTTTACTGACAATGGCTGCCTACAGATCAG
TCCGCAACCTTTCACCAATAACCAGATCCTGTCCTTGGCCAAAAAATACATTCGCCCTTCGCTTTCATGGGAGAACTTTG
AGCTGGAAGACCAGAAGGCAGTACTGAAGGCTCCGCGGTGTAATCCCATCTTTGACACGACAAAGCTTGTCTCAAAACTT
GGTGATCTGGGCTACCGAGTGAAGGATACGCACGATGCTTTGGAGGACATGTTCATCAATATGAGAGCGCAAAGATACTC
TTGAATACGACCTACACCACCCATTTTTGATGGCAATAACAAGTCTTGGCCGGTAGGAAAGCAACAAGGGTGTGTTCACT
AAACAGAAAAGTACAAAAACAGACAAGCTAGCTTTCATTCAATATATTCATAACAGCTAACCTTGAAATCTTCAATATAT
ATACTGAGACAATTTCAGTATTTAGTATTTTTAGTATTTTTTTTCTTATTAAAACAACTTCATTGAGACGATCTTGGATA
ACTAGCGCATTGTGACAATTTGCTTGTTAAGGGTGTACTTAAGCAGGCTGAGTAAGTCAGGCAGAAGAGGATGTATCCTA
GTAACAGGAGGAAGAAGCGGTATATATCGGCCTTTACTGCCAACAATCCGAAACTTGTTCCAACTTTTCTTGACCGCTAT
CCAGAGGGGCTTTCAGGCGCCAAATACGGAAGACAAGGGAACCCGAGACGTGCCAGTTTGTCGACATCGTTCCACCGGGT
TGTGTTTCGGCGCAATCGACAGCAAATCAGGACGACGTCGCGTACGTGCTGCCAGAGAGGATGAGCGCCGCCGCAGCTGC
CGAAGCGGCCGTGGAGAGGCCGGCGATGGCGACGAGCCCGCAATTCGTCTTCTTCACCGACTTTGACGGCACGATCACGT
TGCAGGACACCAACGACTTCATGACGGACACGCTCGGGTTCGGGCCAGCGCTGCGCAAGCAGGGCAACGAGGACGTGCTG
CACGGCCGGCGCAGCTTCCGCGACTCGTTCCAAGAGATGATGGACTCGATCGTGACGACGCCGTACCGCGATTGCATCGC
GCTGCTGAAGCGGGAGATCCGCATCGACCCGGACTTCCAGGCCTTTTTTGACTGGGCCGAGGGCGCCAACGTGCCGATCG
TCGTGCTGAGCGGCGGCATGCAGCCGGTCATCCACGGACTGTTGGCACACTGGCTCGGCGAAGAAGCCGTCGCGCGGCGG
CTGCAGATCGTCAGCAACGGGGTCGAGGCCCGTCCCGGCAAGCGGCTGTACGAGGACGCCGCGGGCTGGCAGCTCGTCTA
CCACGACGATAGTCCCTTTGGCCACGACAAGTCGCTCGAGATCCGCAAGTACTCTCACCTGCCGCCGGCCGAACGGCCCA
CCATCTTCTACGCCGGTGACGGCGTGTCCGACCTCTCGGCTGCCCACGAGGCCGACCTCATGTTCGCCAAGGCCGGCCGC
GACCTCGTCAGCTACTGCCAGCGCGAGAGTGTGCCGTACACCGAATTCGACAGCTTCGCCGACATCCACAAGACCGTCCA
AGCCATCGTTGAGGGCCGGAAGACTGTGGCTGATGCCATCAACAAGTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62