GenePrediction:GLEAN_4031 Details

Name: GLEAN_4031
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2361348..2361851 (+ strand)
Length: 504
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2361348..2361697 (+ strand)
Length: 350
Type: CDS
Source: GLEAN
Position: GCSC_113:2361752..2361851 (+ strand)
Length: 100
>GLEAN_4031 class=GenePrediction position=GCSC_113:2361348..2361851 (+ strand)
ATGGGGCGCTCTCGCCGAATCCTCCACGCGGCTCTCGAGGAGTCTGCCACTCCGCCGGATACCTTGGCGCCAACACAGTC
GTTGGCTCGTGTCATTCAGGCCGAGGGCAACAATCTGTACAGCTGCCTGTTGCCAGCCAGCAATGCGACGACTGCTGCTG
TTGACACCGACAGCAAGGTGTTGGTGGAGCTCGATGCCCGCTTCCGCAACACCGTCTTCATGCGACGAGGCGGTTATGTG
CTCGTGGACCTGGAGAGCGCGGGTGCGCTCAAGGAGGCCGGACGTCGGGTCATGGGCCAGATCGTGAACGTGGTGCGCGA
CGAGAAGGCGTGGCGGAAGCAGAAATACTGGTTAGTGCTTGCTGGATCTGATAGTTTTTCTGGAATGTCATATCTGACCT
CCAGGCCGCGCGAGTTCGCCAAGGCTACGGTGGAGACCTCGGACGATGAGGAAGAGTCCAACATGGGCAAGATGCCACCC
AGCGATTCGGAAGACGAGGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62