GenePrediction:GLEAN_4034 Details

Name: GLEAN_4034
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2386937..2388568 (+ strand)
Length: 1632
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2386937..2387208 (+ strand)
Length: 272
Type: CDS
Source: GLEAN
Position: GCSC_113:2387271..2387288 (+ strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_113:2387701..2388568 (+ strand)
Length: 868
>GLEAN_4034 class=GenePrediction position=GCSC_113:2386937..2388568 (+ strand)
ATGTCGGACACTCTCGGAGGCGGAGTTCAGTTGCAGACGGGTTGCCAAGCGCCCAAGAAGAAACAATCCAAAAGCCTTGC
AGCCCGCGGTCCTACAGCACTGCCAAAGAACAGGGGGACGGGTTTTGAAGGTTGGCTAAAATTTCCGATGGTCACGATCG
TGGCTGTGGACCCCGGCGCAAAGTTCTCGTGTACTGACCCCCTTGGAGAATATTATGCCGAGCCACCACTGGCTCCAGAT
GAGTTTAAGGAGGAGTCAGAACTGTACCACCCGTACGTGTTGCACCCATTATATTCTATCTGGAAGCAGGTCTTGGTGCT
GACCCTGTTCCTAGCTCCGTGTCATTTGATAGGTAAGTCCTGCCGGAAGGTTGCCTGTGTGCTCAACCTGACGGCGGATG
CAAAGTAGACGCATCGAGACTTGCACTCAACGATACCGGGCCCGCCGTCGTATGAACAATGAAAGAGCGCTTCTGTTCAA
CCGATATCTGTCTCTGGGCGGCATCGATTGTCAGCCCCGACAGTTCAATACCACGGCTGGTATCCATGACACCGACGGGT
TGACAAGCGAAGATATTCGAACGATGACAGCAACTGATGTCATTCCACAGACGGCGAGCAAAAATTCCAAGTACTATGCT
TCTGGGAACGATTATATGTGGACGGTTGATTTTACCAGTGTTGTGTCTGGATTTCTGTGAGATCTCGCCTTTACGGGCTC
TAAGTAACTAGAGATGATGCGCACGATTCTGACAGGTAAAACAGGTCTGTAGAGCTTCGCGATTTAGCAAGCTGCAGTGA
GGAACGCCTGCTGATGGGTGTTGATGTTGTCGACAACTTTTTGCGGTATATCCAGATTCACGACGTCTGTCCAGAATATG
AAACCGATGTCAGACAGGCAAGGGTCGTTTGTGACAGGGCCAAGACCGAGTTGATGAGTTGCCGCTACGCACAGACTGCC
ATGCCGGGCCAGTTCAACATCGCTTGCGTCAAGCTCTTTTACAACGAGCCGACTCACAAAGCCTTCAACGATGGCCTAGA
CCCTTTGGACAAGGTTCCCAAGGACTGCGACGCCGAGGCCATTTTTCAGACTACTGTAGCGCTGCAGCCGCGGCTGGCGG
GGAATAAGACCATCGAGATGTCCAAGGATGTCAAAAGCATCCATATTCTTACAACACGCGAGATAGATCTTGAAATATCT
GGCTTAGTCTTACCATCCGACGAGACGGTTCAGCGCTACTCTGCTGCAGGCTCGCCTCGATGTCCGATCTTGCCTGCCGG
TGTTGTTGTGGCCAAACATCACAACATTGATGAAGGCTATGCAAACCAGCCCCGGCCATCTGCGGTGGAGCTTGCTGGTC
GTGGGAACGAAGCTTTCTTCCTGGACCGCGAACTAATGGCGCTTCTGTGTCCAGGCACGAAGCTTCGCGTTGTTGTTCAC
GAGCTCAACTGTGATCTGAACTTCATCTCGACGGTTAAGGATGTGCATCCATCATTTTACACGTTTCTGCCGCAAGAGCT
GATGATGGAGTGGAAGGAACCTAGAGAGAATGACCGAGAGGCTCCGTCCGTTGACAACCCTGATGCCGAAGATGAGGCAG
TCCAGAAGATGGCTGATGAGGAAAAGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62