GenePrediction:GLEAN_4035 Details

Name: GLEAN_4035
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2390192..2391764 (+ strand)
Length: 1573
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2390192..2390227 (+ strand)
Length: 36
Type: CDS
Source: GLEAN
Position: GCSC_113:2390292..2391441 (+ strand)
Length: 1150
Type: CDS
Source: GLEAN
Position: GCSC_113:2391505..2391764 (+ strand)
Length: 260
>GLEAN_4035 class=GenePrediction position=GCSC_113:2390192..2391764 (+ strand)
ATGTCTATTCCCGGCTTGGGACAGATCCCTGTCCAGGTAAGCGGACAGTGTTTCTGTTATGATACTCCATGGCAGGGATG
CATTCTGACAGCTCTGCCAGGCCCCGGCGTCATCGAAGCGCATTGTCAAGCTCACGCCACTGTCGGAATGGCGTTTTGCC
GTGTCCCAGCCAGCAGTGCGGATCCGGCTCCTCTCCGGCACGGCCGAACGCGACGGAACGGAGTTGGCCTCGAACCAGCC
GTACAGCTTTGCCCGCACGCAGTCCAAACTGTTGACCTGGCACGGCTGTGAGCTGGAGGTTGACGGCACGTGTGACCGCG
AGTCGGTGGCGACGGTCGGCAGCAGCGGCCAGTCTGCCACGACTCCGCCGCCAGTCGTCTCGTACCTGAACCTGCACATG
CTTCTGGCAGCCGAGCGTGCAGCTGTGCCGCCGCCGGGATCGTCTGCTCGGCCAACGGGCGGGCCAGCGGGGCCCCGAGT
ACTCGTCTGCGGCGGCCCACAGACTGGCCGGACGAGCCTCGTGCGCACGCTGGCGGCATGGGCCACCAAGATGGGAGGTG
CCGGCAGCAGCTCGTCGGAACCACAGCACCAGCAGCAGCAGCCTTGTGTGGTGAACGCGGACCCGCGCGACGGCCTGCTA
AGCCTGCCAGGAACGCTCAGCGCGGCCGTGTTTGGCACGCTGATGGACCTCGAGACCGAGGGCGGCGGCGGCTGGGGCGG
CGCGCCGAGCAGTGGACCCAGCGCCGTGCCGGTCAAGCTGCCACTCGTGTTTGGTTTTGGCTATGCGCGGCCGGCCGACG
CGCCAACGCTCTACCGGGATCTGGTTACGCGTCTCGCCGGCGCCGTGACAGCCCGCATGTCCGACGACCCGGCCGTGCAC
GCCGGTGGCCTCTTGATCGACACGCCGGCCGCTGAAGCCGAAGCCGGCAACGTCAACGCCGACATCGACCTGCTCGCACA
TATCGTCGACGAGTTCTCGGTCAACCGCGTCGTCGTCCTTGGCGCCGACGCCCAGCTCTACTTTGGCCTCGCTCAACGTC
TCGCCCGCGAGACCACCACGTTTGGCGAGCCCGTTCAGGTCATCCAGCTCGACGCATCTGACGGCGTGGTCGCGCGCACA
AACAGCCTGCAGCAGCAGCAGCACGAGGCCTGCATCCGCGAGTACTTTTTTGGCGACGCCAAGCGCACGCTGGATCCGTA
CACGCAGCTGGTCGACTTTGACGCGCTGACCGTCTACCGCCTCCCGGATGGTATGTAACGCCTCCTCCCCCGCTCTTCCA
TCATCACAGACGCCTGCTAACCAGAACGTGCAGCCGGATCGGCCGACTCGCGGCTTGAAAAGGTCGAAGCCTCCAACGCC
CTCATGCACTGGACGCTGTCCGTCATGAACGCGTCAAATCACGACCCGCCCGACGTGGTCCAGCACGCGGCCGTACTGGG
CTTTGTCTACGTTGCCGACGTGGAGGCGGACCGGCGAAAGATGCGCATATTGGCCCCTGTGAGCGGCCGACTGGGCGATC
GACCTCTCGTGCTTGGCCGCTGGCCTGAGCCATACATCAACCTTGTGGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62