GenePrediction:GLEAN_4037 Details

Name: GLEAN_4037
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2396384..2398006 (+ strand)
Length: 1623
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2396384..2396511 (+ strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_113:2396596..2397093 (+ strand)
Length: 498
Type: CDS
Source: GLEAN
Position: GCSC_113:2397177..2397319 (+ strand)
Length: 143
Type: CDS
Source: GLEAN
Position: GCSC_113:2397386..2397552 (+ strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_113:2397602..2398006 (+ strand)
Length: 405
>GLEAN_4037 class=GenePrediction position=GCSC_113:2396384..2398006 (+ strand)
ATGGCGACAGACACTCCGCCAGCGGCGGCCACGGCCGACCAAGAGCAGGACATCAATCCCTGGTCGGTGCAGGGCGGCGT
AGGCGCAAACGGCGAGGTTGTCGCAATCAACTACGAGGCCATTAGCAAGTATGTCTGACAGAAAACGGCGTGTTTGGCTT
CCAGCCAGGCCTATGCTCGATCGCTGACCCGGCTGTCTCCTTTGTACTGCAGAAAGTGGAGCACAAGCCTGGTCGACGAG
GCCCTCCTCGAGCGCTTCGAAAGGGTCACCGGACACAAGCCGCATCGCTGGCTGCGGCGCGGCCTCTTCTTCAGCCATCG
TGACTTTGACCGCATCCTGACCCGGTATGAGCGCGGCGAGCCGTTCTTCCTGTACACCGGTCGTGGCCCCAGCTCGGGCA
GCCTGCACCTGGGCCACACGATCCCGCTGCAGTTCACCAAGTGGCTGCAGGACGTCTTCGACGTACCACTCGTCTTCATG
TTGACGGATGACGAGAAGGCCCTCTTCCGGGACGGCTTGGCCTTTGAAGACACGCTGCAGTTCGGTCTCGACAATGCGCG
GGACATTATCGCCCTCGGCTTCGACATCAAGAAGACGTTCATCTTCAGCGACCTGCAGTATGTGGGAGGTCACTTCCTGA
TGAACGCCTGGGAGTTCTCGCGGCTGGTCACCTTCAACCAAGTCCGCGGCGCGTTCGGATTCAACGAAAGGTGTGTTGCT
GCCATTCCGGGCAAATCCCTGTTCCTTTCTGTATGGCGTCCTGCTGACACAACATCAGCACCAATACTGGCAGGATCTTC
TTCCCCTCGGTCCAATGCGTTGCAGCATTCGCTACTTCCTATCCAGAGCTCTGGTCAGATGTCCCGGCAGCCGAGCGCTC
AAAGGAGGTTGCCAGCTGGCAATGTCTGATTCCCATGGGCATCGACCAGGACCCGTGTAAGTTCAAAGCCTACCCCTGAC
GATGAGGACGTCAAGTTTCTACATTCTCTGACATGCATCCAGATTTCCGTCTCCTTCGCGATAACACTCACCGCATGCGG
TACCCGTCGCCAAAACCGGCACTCATTCACTCCAAGTTCCTCACTGCCCTGCAAGGTGCTGGCGGCAAGATGTCGTCGTC
GAACCCCAATTCTGCCATCTTCATGACGGACACTGCCAAGCAGATCAAGGTGCGTAAAGTCCAGAAAGAAGAAATCCGAA
CCGATGCTAATTAGACAGACAAAAATCAACAAGTATGCATTCAGTGGCGGACAGGCCACTCTCGAGGAGCATCGCGAGAA
GGGCGGCAACCCCGATGTGGATGTGGCATATATCTACCTGACCTACTTTGAGGAGGATGATGAGAAGCTCGCCAAAGTCT
ATGAAGATTACAAGAAGGGTGAGTTGTTGACGGGCGAACTCAAGAAGCTGGCCATCGAAACTCTGCAGAAGTACGTGGAG
GAGTTCCAGGAGCAGAGAAAGCTCGTGACGGACGAGGTGTTGAAATCGTATATGACACCACGGAAGCTCGTGTGGGGTGG
AAACCCGAACCCGAAACCGGTGCCGAAGCCAGAGCCGGCAGCCAAAGGGAAGGCAAAGGGCAAGGGCGAGACGGTCCTGC
CAGACAGGACAAAGGAGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62