GenePrediction:GLEAN_4039 Details

Name: GLEAN_4039
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2404612..2405147 (+ strand)
Length: 536
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2404612..2404783 (+ strand)
Length: 172
Type: CDS
Source: GLEAN
Position: GCSC_113:2404837..2405147 (+ strand)
Length: 311
>GLEAN_4039 class=GenePrediction position=GCSC_113:2404612..2405147 (+ strand)
ATGCCAGCCGAAGCTTGGTATAAAAGGGCCTATGGGTTTGCCAGAGAAAATCCCGGCACGACCGCTCTGTACGCCACTTC
CGGTGTTGCCACTGCGTTCATGGTCGCTCCGATGGCCGTCGCCGGTGCCGGCCTAGGGCTCATAGGATTTACGGCCAACG
GCGTAGCCGCAAGTAAGTTTCTCTGCGTACCTACTCGGTGATCGTGTCGGCTGACCCACAATCAGCCTCTATGGCTGCCG
GCTGGCAAGCATCCATCGGCAGCGTTGTGGCACCGAGCCTGTTTGCCACGCTTCAAAGTGCCGCTGCCGGTGGCTATGGG
GTGGCTGCTGTAGGTTCGGCAGTCAGCTCGGTGTCCGGCCTCCTCGGAGTCTCGACGGGCGTGGCGGCCGCGCTGCGCAC
GAAGAAAAAGCGCGAGGAGGGCGACGACGATGACGATGATGATGCGGATAAAGATGAAGAGGCAGAGGATACGGCAGAGA
CAGTCGTGGGCGAGGAAGATACTTTCATAGAGAGAGGAAGAGAGTCAAAGTCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62