GenePrediction:GLEAN_403 Details

Name: GLEAN_403
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1564924..1566670 (+ strand)
Length: 1747
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1564924..1565113 (+ strand)
Length: 190
Type: CDS
Source: GLEAN
Position: GCSC_167:1565176..1565735 (+ strand)
Length: 560
Type: CDS
Source: GLEAN
Position: GCSC_167:1565820..1566430 (+ strand)
Length: 611
Type: CDS
Source: GLEAN
Position: GCSC_167:1566502..1566670 (+ strand)
Length: 169
>GLEAN_403 class=GenePrediction position=GCSC_167:1564924..1566670 (+ strand)
ATGTTGAAACACGAACCTAGCCGTATTGAGCCCAAGAGGCGCAACGTCCTCGATCACCGCAAGAAGCAGTTTGCAGACCC
TCAATATCGAGAAGCGCAGTATCCGACTCGCCTCAACTTCTATACCGATTCGCCAACGTCAGATATCACACTCGAGCAGT
TTGAGCAATGGGCCATCGACAGACTACACGGTTAGGATATACGCCTACCGCTTCCGTCAGATTTGCGCCGTGCTGACGAT
ATTGCACTACAGTCCTCGCAGAGCTGGAAGCATGCTCGTTTCGAAATAGATCGTCCGCAGAAACAGCATTGCACATGAAG
TCGATCATGGAGAAGTATATGCCGTTAGAGGCCAACAGTAGCTCGTCAACAAAGCTGGCTGCTCAGAGAAAGAAAGACCA
TTACAGTCATTTCATCCTGAGGCTTGCCTTCGCATCGACGGAAGACCTACGGCGGCGGTTCGTACGAGTAGAGACAATGC
TGTTTCGGTTACGGTTCGGTGATGATGACACCCGCGAGCGTGCAACATTTATCCGAGGCCTGAATTTAGACTGGGAGATG
GTGTCAGACGAAGAGAAGAGCTCGTTGGCGACAGAACTTGCGGCTGTGAGCGCCTCCAGCTTTGGAGGACAGCGGAAGCA
GCAAGCCGTCATAGAAGAAGAGAGCTGGTGCAAGGTGGATTGGATGCGGGTGCCCGAGCTTGTTGAAGGCCGTAGGGTGT
TTCTCAAGGCCGGAAAAGCCTACGTGCCTTCGAAGGAGCAAGCAAGTATGGTGGCGACCGAGTTCTCGGGTCGTCTGGAG
AGGGCGCTTGAGGTATGCAACACTGAAAGACCCGACACAAGCACAGCAGCGGACAGGGTTTGGTGCTGAATGCTAACGTT
GCTGGTTTGCTGTCAGCTCACAGCCCGTGCCTTGCCACGATTGGACGAAGACGACCGCCTGACGCCAATTCTCGACCATC
TGTCTAAGAACTTCGTTACGCCCGACGCATCATTTTCGGGGGCTGACGGCAATAATTCCGGTGCAGAGATTAATGCACGC
AGCATCGATACGTTGGCCCCAGCGCACTTCCCGCTCTGTATGCAGAACCTGCACCGCTCGCTGAGGCGCGACGCACACCT
GAAACACTATGGCCGTCTGCAATACACGCTCTTCCTCAAGGGGATCGGCCTGAACCTGGAGGAGAGCCTGTTGTTCTGGC
GACAAGGCTTCCATAAGATCACCGATGACACGTTCAACAAGGAGTACCGCTACAACGTACGACACGCCTATGGCGAGGTG
GGCGGCGACATGAACCGGCGTGGGGGCGGTTACAGCCCGTTTAGCTGCCAAAAGATCTTGACAGAACACACGCCAGGTAC
GGGCGACGCTCACGGCTGCCCGTACCGACATTTCAGCATGGAGAACCTCACGACCTTCCTGCAGGGCGTGGGCATCAATG
ACCGCGCAGTGCTGCAGGGCGTGAAAGAAGACAAGGACAAGCAGAAGTTTCATATGGCCTGTAATCGGTACGTGCCCCCC
ATCTTATGTGTGTTCTGCTTGTGAAGGGTGAGATAAGCCGGCTAACCTATCGGCTTAGTGTTTTTGAGCATGTTCACAAA
AATGAGCTTAGACGAGCAAAGGATGAGAGCGTTATGACAGCTGCACAATTGGAGACAATTGTGCACCCGAACGAGTACTT
CAAGCGCAGTTACCTGCTGAAAAGCCTGGGCAAGAGCACGACAGGTGACGTCCGCATGGAGGGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62