GenePrediction:GLEAN_4042 Details

Name: GLEAN_4042
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2411879..2413580 (+ strand)
Length: 1702
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2411879..2412068 (+ strand)
Length: 190
Type: CDS
Source: GLEAN
Position: GCSC_113:2412134..2412593 (+ strand)
Length: 460
Type: CDS
Source: GLEAN
Position: GCSC_113:2412650..2413580 (+ strand)
Length: 931
>GLEAN_4042 class=GenePrediction position=GCSC_113:2411879..2413580 (+ strand)
ATGCCGGTTCGGCCGGCCGCGGCCAAGAGCAACACTGCCCTTCCGGCGTCGGCGTCAGTGCGGCGACAGGCCTCGACAGT
GGCGGCTACGGCGGACATGACCACAACTAACAGCGACGACATCGGCCCCATCCAGGAGTATGACCGGCGCGTGGCGGCCG
GAAGGCTGCGCAACGATGAGCACCAGCGGGGTAAGTGAAGTCTGAGACGGCAGTAGGTAGCCGAAACGACTGTTGCTGAC
GAGCCCCGAAAACAGGAATCATACAGAGCCTTCAGGACATGCACGATGAGCTCCGTAACTACGAGGCGCCACTGGTCGTC
CACCCGAGCATCGACAGCCTCGCGGCCAAGCCGTCCCAATCGCTACTGGGCTCCTGGTTCGGCGGCGGGAACAAGACCGC
GAAGTCGGCCGTCGGCAATATCCCTGAGAACCTGCCGATGGGCCTATACCTTTATGGAGACGTGGGCAGCGGCAAGACGA
TGCTGATGGACCTGTTCTACGACACGCTGCCGCACAAGGTACGCAGCAAGCTGCGCATTCACTTCCACAATTTCATGCAG
GACGTGCACAAGCGGCTACACAAGCTCAAGATGCAGTACGGCAACCATGTAGACGGGATTCCGTTCATCGCGGCCGACAT
CGCCGAGCAGGGCAACGTGCTGTGTTTTGACGAGTTCCAGTGCACCGACGTGGCAGATGCGATGATTCTGCGCAGGTGAG
TTGTGTGTGTGTGTGTTTGTGTGCGTTTCTGGTGCTCTTCTCACATGTCAGACTCATCGAAGCCCTCATGGCCAATGGTG
TGGTGCTCATCACGACGTCCAACCGCCACCCCGACGAGCTCTACAAGAACGGGGTGCAGCGCGAGTCCTTTATTCCGGCC
ATTGAGCTGCTGAAGCGGCGGCTGCACGTGATCAACCTCGACTCGCCGACAGACTACCGCAAGATCCCGCGACCGCCATC
GGGCGTCTACCACACGCCGCTCGACAGCCACGCGCAGTCGCACGCGGAGAAGTGGTTCCGCTTCCTCGGCGACCCGCGGC
AGCCAGAGTCGCACGCCGAGGTGCAGACGGTTTGGGGCCGCGAGATCCTTGTGCCAAGGGTCAGCGGCCGCTGTGCCTGG
TTCACGTTCGACCAGCTGATCGGCCAGCCGACGTCGGCAGCCGACTACCTCGAGCTGGTGCGCGCCTACGATGCCTTTGT
GGTCACCGATGTGCCCGGGATGACCCACCGCCAGCGTGACCTGGCCCGCCGGTTCATCACGTTCATCGACGCTGTCTATG
AGTCACACGGGAAGCTGGTGCTCACGACCGAGGTGCCGCTGAACCAGCTATTCGTGTCCAAGGCCGAGATCCGCGAGTCG
CTCGCGAACAAGAAGGCCGGCAGCGGCAACAGCAGTAGCAGCAGCAGCCGCGCCGCACAGAGCGCCGCGGCCGCGGACAT
GGCCGAGTTCGAGGTCAACGAGACGCTCGAGGAGCTCGTCGAGGGCATGGAGGGCCACAACATGATGCAGCAGCTCAAGA
GTTCGAACCTGTTTACCGGCGAGGAGGAGGCCTTTGCCTTTGGCCGCGCCCTCTCTCGCCTGACCCAGATGGGCAGCAAG
GAGTGGGTTGAGCGGGGTATGGGACTCGAGGAAAAGGGCGGCAAACAGGAGCATGACGGCTACAAGAAGATGCGCAGCCG
GCAAATGGAGGATAGCATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62