GenePrediction:GLEAN_4044 Details

Name: GLEAN_4044
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2416468..2418918 (+ strand)
Length: 2451
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2416468..2416725 (+ strand)
Length: 258
Type: CDS
Source: GLEAN
Position: GCSC_113:2416786..2416892 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_113:2416946..2418392 (+ strand)
Length: 1447
Type: CDS
Source: GLEAN
Position: GCSC_113:2418445..2418918 (+ strand)
Length: 474
>GLEAN_4044 class=GenePrediction position=GCSC_113:2416468..2418918 (+ strand)
ATGTCCTGCAACCAGGAAATCCTGGCTGACAAGGCTCTGGGCGATGATATCGTCCGTCTCTGCACGTCAGCCGACAGCGT
CTCATCTCTGCTAGCCACCACGCCATCGCTATCACCTGGTGAAGCCTGGAAACAGCTTTATGGTGACTACAAGCCTACCG
CGGCAACCAACCGCAAGAAGGCAGATGATGCAGACCTGGATCGGGCTGCCCAGTGCGGCAAATGGGGCCCTACCCAGCCA
AGCGATACATTTTTGCGTGTAAGAATCTTTGAGTGGACTGTCCATAAAATGTCTAACAATTACGCTGACACGGCCCAGAT
ATACCGCGATGTTTTGGCCGTTGTGGAAGAAAGTCCAGATCGAGCCATGGTCAGCCCGCCATTACTTGGCAGCTGCGGAG
TGACACCTCTGACAATCATATCGACGTAGGAATCTTGACTCCCCCGCTGAGTCCAAAACATATCTGACCTTCTCCCAGAA
TTCCCGATATTGTCAGACACATGGCCAATGTCATTGCACGCGCAGAGAAGGAGGTTTTCCTCGCAACAAACTACTGGCAG
GACAGCGTTGCGTCGACATATCTCACAAACGCCATCAGAGAGCTCGACCGTCGTGCGGGTCAGAGAGGTGCCCGGATTGT
CATGAAAATCATTTACGACCGCGGCAGCCCCAAACAATTTATCGACCCACACCATCTTGTCGGCGAAGACGAGTACACAG
GAAAGAACGTAGCCCTTCCTGCATCGAAGGACATCCCCAACATTTCGATGGAGGTCATGAACTACCATCAGCCCATTATG
GGCACATTCCATTCCAAGTATATGGTTGTCGATCGCAAAATTGCTATATTGCAGAGCAATAATATCCAGGACAACGACAA
CGTGGAGATGATGGTTCACTTTGAAGGCCCGATTGTGGATTCGTTCTATGATATGGCTTTGCTTTCCTGGAACAGGAAGC
TTGAGCCGCCTCTTCCTAGCCGCAACTCGCCGGCCTCTGTTGTGGGCTCTGGTAGCTATACCGAGCAGAGCGGAGAGGTG
ATTGCTGGAAACCATCCTGCTGGTAGTTTGGCCTCAACTGAAGGAACAATTGAAGGACAAACTGTAGGAACTGATGGACC
AATAGGGGTCACAAGTGGAGTCACAGCTAAAGGAACAACACATGACAACCCATCTGACGAGGCTGTTTTAAGCAAACAGA
TGCAGGAGGCTTCGATCCAGAATACTGCCACAGAACTACTAGGCAGTGATCCTCGTCAATCTGAGGGATCGAGACCTGCT
GGCAGTGCGAGCAGCACCAAAGCAGAAGGACTTCCACCCAAAGAATCAACCAGCACAACACAAGATACAGTGCAACAAAA
GCGTTCAGAACTCCGACCTAACAAAGCCAACGGTCCAGATCCGGGGATACAAGCGTTTCTTGACAGCGGGAAACAGCAGA
TTCCGAGATGGTGTCTTAAGCAACCATCATCCAGCATCGATCTCCCTCAGAACACGTCAGAACATCCCCAGTATGATGAA
GACATTGCCCGGGAAATAGTCCGCGTGCAAGCTTCTCTGCTTCCTCGGCCTGGTAAGACAGAGATGGAGGCTATCACACG
GTTGTTGAACCACACTACCAATCACTTGGCCGGTGACGCTCCCGACTTTTCCGAGGGCGACGAGATGACCCCCTATATTC
CACACGACACGCAGACAAGGATTCCTATGGCCATGGTTAATCGTCCTCCTTATGGCACACCAACGCACTACTCCGTTGTG
CAGCCTCAAAATGTTGCCTGGCTGTCAGCGTTACGCCATGCTCGCAAGAACATCTTCATCCAGACACCAACTCTGAATGC
GGAACCGCTAATTCCAGCTATCCGAGAAGCCTGCGAGAGAGGTCTCGATGTCGTTTGCTATATCTGCATGGGGTATAATG
ATACGGTAAGATATTCTTTTGATTATCGGTGATGATAAAATTCTGACTGCTTGATAGGGGGAGCTCTTGCCCAAGCAGGG
TGGGACTAACGAGATGATTGCTCACAAGCTGTATGGGTCGCTGTCGGACGAAGGCCGCAAGCACCTCCACTACTTTTGGT
ATGTGGGCAAGGACCAGACGCGGCCGATTCCGCAGATCAAGAAGAACCGGGACTGCCACATCAAGCTTATGATTGTGGAC
GAGAGCATTGGCATCATGGGTAACGGAAACCAGGACACGCAGAGCTGGTATCACAGCCAGGAGATCAACATCATGCTGGA
GAGCTCTGACGTGTGCCGTGCCTGGATTGAAGGCCTGCGGCGCAACCAGAACACGCACATCTATGGCATGGTGGGCAAGG
CAGACGGGATATGGCGTGACAACGAAGGCATTGAGGCTGAGGGTGCCATGGGTATCGACCCTGGCCATTTCAGCTGGTTC
AAGGGAGTTGTGGGTGCTATCAAGAGGGCCCAGGGTAAGGGCGGGTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62