GenePrediction:GLEAN_4045 Details

Name: GLEAN_4045
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2422159..2423984 (+ strand)
Length: 1826
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2422159..2422246 (+ strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_113:2422317..2422402 (+ strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_113:2422464..2423984 (+ strand)
Length: 1521
>GLEAN_4045 class=GenePrediction position=GCSC_113:2422159..2423984 (+ strand)
ATGGCGTCAATGTTCGAGCAGTCCCGGACGGGGACTCTCTTCCTGGGCGGCCAGAAGATCTCAGGGGCTGACATCCGCGA
CCAAAATGGTGGGCATCCACTCTGGCAATGCCATGTTGTTCTGTTGGGTGCTGTTTATGCTAACAACGGAATGCGCAGTG
ATTGCAACCCAGGCCATTGCTAACGTCGTCAAGAGCTCGTTCGGGCCGAGCGGGCTAGACAAGATGATGGTGGACGACAT
CGGCGTAGGTTCTCCGTGTGTTGGCCGTATGTGGCCGTATGGAAAGCCGGTTCTGACCAATGCAGGACGTTACTGTGACG
AATGATGGTGCGACGATCCTCACGCTGCTAGACGTCGAGCACCCTGCCGGCAAGATCCTGGTGGACCTGGCACAGCAGCA
GGACAAGGAGGTGGGCGACGGGACGACGTCGGTGGTGCTGATTGCGGCAGAGCTGCTGCGTCGCGGCAACGAGCTGATGA
AGAACCGCATACACCCAACGACAATCATGACGGGGTACCGGCTGGCACTGCGCGAGGCGATCAAGTACATGAACGACAAC
ATCAGCATCAAGGTGGAGCAGCTTGGCCGCGAATCGCTGATCAACATTGCCAAGACGTCGATGTCGAGCAAGATCATCGG
GTCGGACTCGGACTTCTTCTCGAACATGGTGGTGGACAGCCTGCTGGCGGTCAAGACGACGAACAACCGGAATGAGACCA
AGTACCCGGTCAAGGCAGTCAACATCCTGAAGGCGCACGGCAAGAGCTCGCTGGAGTCGGTTCTGGTCAAGGGCTACGCG
CTCAACTGCACGGTGGCGTCGCAGGCGATGAAGACGCGGATAACGGACGCCAAGATTGCGGTGCTGGACATGAACCTGCA
GAAGGAGCGGATGAAGCTGGGGGTGCAGATCACGGTGGACGACCCACAGCAGCTGGAGCAGATCCGGGCGCGCGAGGCGG
GCATGGTGCTGGACCGGGTGGACATGATCCTGAAGGCGGGAGCGAACGTGGTGCTGACGACGAAGGGGATCGACGACCTG
GTGCTCAAGACGTTTATCGAGCGTGGAGCGATGGCGGTGCGGCGGTGCAAGAAGGAGGACCTGCGGCGGATCGCACGGGC
GACAGGAGCGACGCTGCTGAGCACGCTGTCGGATCTCAACGGCGACGAGCGATTTGAGGCGTCGTACCTGGGCCACGCCG
AAGAGGTGTCGCAGGAGCGGATCTCGGACGACGAGTGCATCCTGGTGCGCGGACCCAAGGTGTTCTCGGCAGCGTCGATT
ATCCTGCGCGGGCCCAACGATTTTTCGCTCGACGAGATGGAGCGGTCGGTGCACGACTCGCTCTCGGCCGTGAAGCGGAC
GTTGGAGAGCGGCGCGATTGTGCCGGGCGGTGGTGCCGTGGAGACGGCCCTGCACATCTACCTGGAGGAGTTTGCCGGCA
CGGTGGGATCGCGTGAGCAGCTGGCGATTGGCGAGTTTGCGCAAGCGCTGCTAGTGATCCCCAAGACGCTGGCAGTGAAC
GCGGCCAAGGACGCGTCCGAGCTGGTGGCCCAGTTGCGGTCGCGCCACGCCCTCTCGCAGCGGACGCAGGAGGGTGCGGA
CGAGGATGAGAAGACGCTCGCGCGCAAGAAGGGCTACAAGAACTACGGCCTGGATCTGGCTCGCGGCCGTGTCGTCGACG
AGGTCAAGCTGGGCGTGCTGGAGCCGACGATCAGCAAGGTGCGCCAGCTCAAGAGTGCGGTCGAGGCCTGCATCAGCATC
ATGCGCATCGACACGCTGATCAAGCTGGACCCGGAGCAGCGGGAGGACGACGGACACGGCCATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62