GenePrediction:GLEAN_4047 Details

Name: GLEAN_4047
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2441557..2444108 (+ strand)
Length: 2552
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2441557..2441708 (+ strand)
Length: 152
Type: CDS
Source: GLEAN
Position: GCSC_113:2441797..2441931 (+ strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_113:2441990..2442610 (+ strand)
Length: 621
Type: CDS
Source: GLEAN
Position: GCSC_113:2442677..2442945 (+ strand)
Length: 269
Type: CDS
Source: GLEAN
Position: GCSC_113:2443012..2444108 (+ strand)
Length: 1097
>GLEAN_4047 class=GenePrediction position=GCSC_113:2441557..2444108 (+ strand)
ATGCCGCCTGTACGCATCAAGTCGCGTCCCTTGCCGGGGACCGACGCCGACCTGCGTTCTCCACCCCTGTTTGAGATCCG
GGAGAAAATCACGTCTTTGCCAGATATTGGGGTAGGAGACAGCTTCCGCGATGTCATCAAGAAGCTTTCAGTGTGCGTTA
TGTCGCCTTTTGAGGGCGAATAGGGGCGATTGGTGCTCTGCGCAAGCTCTGTTTCACATATGCTAAACCGGTTTACACAG
CTTCTTTGCCAATGCCGTCACGCTACCTTGCTCTTTCGAACAGCTCCGAACAACGTCGGCCGGAGACAGACTTCGTTTGC
TGGTGACACATCTCAGCAATACCTGTGAAAATCCATGTATTGTGAATGCTCTCTTGTGAGTTTCAGGTCGAATCGCTTGC
TCCAAGACCAGTCGACTAACCTTGTACTTGTAGGGCTCTAAAATGGCATTATGGCGCGTCTGGTGACGATCGTGGCCTTA
ATGAGGCCAGGGCCAATGCTTGCGAAATTGTCGCCTGGCGCTTCTTGACGCACCTCAGCGAACGCGAGGCCGTCGACTTC
TGTCTTTACGAAATACCCGGAACGAAGAAGGCATCTGGCGTCGTCGCGGCCATCACGGAAACCGACGGTAGGGATGAGGA
GAGCCGTGGTGCCGACAATGACGGTCTTGGCCGTGATCCCAACGAAACCTCGCCACTGCTGTCACAGCTCTGGTCGTCGG
CTCCTGCGGACCAAAGCCGAAACAGCACGCGTCGCTCTGCCGGCAAGCGCTACCAGCTGCTGCAGTCCATCTCCCGACTG
ACGATGAGTATGACCTACGGCCACGACAACGACGGCGATGACGACGGGGACGATGAGGACGACCCTACGGCGCCTTTTGT
GCAGCTCAATGCTCTCGAGATTGCTGCCATTGCGGACGCGAAGCGATTCCTCAGCCAAAAAGTCGTGCAAAAAATCGTCA
CCGGTATCTGGAACGGCGACATCGTGTTCTGGGGCCGGCTCGAGGTTGATGCTGTCAAGAAGCCCCAGTTCTACAACCCG
CACACATCTGACCCGTGAGTTCTCCTGAGGTCAAATCCCTCCACGCTCGTGATTGTCATGTCCAACTACTGACCGTACAG
ATACTCTCGTTTGCGGGTGCCCAAGTACCTCAAGTCTTTTGAGATTGTGTACTTTATGCTTTTCCTTGCTATCTTTTACA
TGACTTTGCTTGATCGAAACCCTGAACAAATATCCTTCTCCGAGGGCCTCTTCTACGTCTTTCTGGCTGCGTTTGCCTAC
GATGAGATGAGCGAGTGGATTGATGCCGGCTCCATCTTCTATGTATACGATCTCTGGAATGTGTTCGACCTGATCATGAT
CTGCCTCGGCGTTGTCTTCGCCGCTGTCCGTAAGTTTCCATCAGTATACTTTCTCTTTACTATGATAATCAGCCTTCTAA
CAATGTTCGACACAGGCATGGTTGGACTGTACAAAGGGGACTCCTATCTCACAAATTTGGCATTTGATATTTTGGCCCTG
GAGGCCATGTTCATGGTTCCACGCATCAGCTCGGTCTTGAGCCTGAGCCCGTACTGGGGAACGCTCATTCCATGCTTCAA
AGAGATGACTAAAGATTTCATCAAGTTCATGGTTCTGGTCGTCATCATTTACCTGGGCTTTCTTACTACCTTCTCGCTTA
TTGGCCGGGACGCCTTCTCGCTTCCACACATGACCATGATCCTCACCAAGATCTTTTACGGCTCAAGCTACATCGGCTTT
GATATCATGCACGAAATCGATCCTGTTTTTGGACCCCCGCTGATGCTCATATTCATCACCCTGAGTTCCATCCTGCTCAT
GGGCTCGCTGACAGGTATGCTGAGCAACAGTTTCAGCCGTGTGATAAGCCACTCGCGGGAGGAGTACTTGTATGTCTACT
CGATCTACGTGCTCGAGGCATCGACTAGCAATCGGCTTACACACTTCTACCCGCCCTTCAACCTCATCGCGCTGGTCATC
TTCCGGCCGCTGCGACTGTTTTTGCCTTCCGACACGAGATTTCGTGCCGCACGCATTGCCCTGCTCAAGGCCACACACAT
GCCGATAGTTGTTGTCATCCAGTTCTACGAGTTCTTTCGCGGTAAGGTCCAGCACACCAGCGACCGGTATTCTGTCATCC
AGGGTCCACATCAACAGACGATATCTGGCACCGCCGCTGCCAGCAGAAGAGGCGAGTCAAACTATGCTATTGGCTCTGTC
AGGGGAGACGCATCGGAAACGTCCAAGAGACTTGCGTCTCGCCCTTCTACAGGATACGGGCCGTCGTCATCCGTGTTGCG
ATATGACCCACGGCCATTGAGCTCGACAGGCTCTATACAACCGCTCTCTACGAACACTGTTGCGCCCGGGGCCTCTGTTT
CTACGCCAACAGTCAGCATGTCCGCAGAAGAGGACACGGAGATGGAGGCACCCAGTGACACTGAGATTCGCATCGCAGAG
CTGTCAGCCAAGATTGATAGATTGACCGAGATGGTCTCGCAAATTATTGCCTCCGAAAGCAAAACAAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62