GenePrediction:GLEAN_4048 Details

Name: GLEAN_4048
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2449247..2450626 (+ strand)
Length: 1380
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2449247..2449422 (+ strand)
Length: 176
Type: CDS
Source: GLEAN
Position: GCSC_113:2449495..2449752 (+ strand)
Length: 258
Type: CDS
Source: GLEAN
Position: GCSC_113:2449831..2450626 (+ strand)
Length: 796
>GLEAN_4048 class=GenePrediction position=GCSC_113:2449247..2450626 (+ strand)
ATGGACACGCTCCTGGCATCGTCTGCTGGGCCGCTGTCCCGGTGCGACGACCTCAGGGCCCCCGGCGTGGTGAACCTCAT
CGTTTCAATGTACGTGGCGGCGGGAAATGGCGGCGTGGATTACGAGCAGGACGACCGGAAAGGAGACAAAGGTCACCGTG
CTGGTGTTCCTCTGTTGTGTTTCCGGGAGTCTCATTCTCATCCATTGACTCGTAGGACCACGGATAGCTAACTTGTGCGC
GTCGTCAGATTCATACTCGTCGGCATGCTTGTCTCGTACCTCCCGCAACACATCCGCATCATCGCTCGTGGCACATCCGA
AGGCATCTCGCCCTACTTCGTCCTGCTCGGCGTCACATCTGCCACATCCGGATTCGCCAACATTCTGACCCTGCCCCAGT
CGCTCGAGGACGTGGCCTGCTGCAAAGAGCTCGACACCTTCCACTGCATGGCCGGACTGCTTGGCATTGCCCAGCTCGGC
GTCCAGTGGATCTGCTTTGCTTTCATGTAGGTGTACCCTAGGCCTCTTGCGCGCGAATGTCCGATGATCTTGTCTGACTT
CGAGCTGTTGCTCGCTCTCTGCAGTCTCGCCCTCTTCCTCGTCTTCTTTCGCTTCGACGATGCCAACGTGCCCATTCCCG
AGGAGGAGATCCGTGACGAACAGCCCCGCTGGCAGACCGCCGTACTGGTTGCCTACATCTGTCTGCTGCACGGCTTGCTC
GTCATTGCCCTAACGGCCGTCTTCGCGACCGTCTTCCCCCAGGCTCTTTCGGGCTGGGCCAACGCCCTGGGCTTGATGGC
CGCCCTTCTCGCCGCCGTCCAGTACTTTCCGCAGATCCACACCACGTATCGGCTCAAGCACGTCGGCAGCCTCAGCATCC
CCATGATGTGCATGCAGACCCCGGGCGGCTTTGTGTTCGCTGCCAGTCTCTTTGTACGCCTCGGCTGGGGCGGCTGGAGT
TCTTGGGGCATCTTCCTCCTCACCGCCACCATGCAGGGAATCCTGTTGAGCATGGCCATCTACTATGAGCTGCAGCGCGC
CTTCCCGGATGACGAGGACAGCGACGAAGATAGCGACGATGCAGCCAATGTCAGTGGAAATGGCAACGGGAACGGCAGGA
TCGGTGGGAATGCTCATCCCAAGGTGCACAGACCGCTCTATCGCCGCGTCCTGTCGTACCGGTCGGCCCGTCTGGACGAA
AACACGCCCAGCCGGTACAGTGCCCACCCCGAGCACTACGGCACTACGCCCGACGAGATCTCAGACATTATCGATCGTCA
AGACAGCGACGCGGCGACGGAAACACAGCCGCTTCTGCGGCCGGGCGGCATCGGCAATCCGCGTCGAGAAAACGACGCTC
GCCGCCGCTCTGGACATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62