GenePrediction:GLEAN_4049 Details

Name: GLEAN_4049
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2455280..2456106 (+ strand)
Length: 827
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2455280..2455445 (+ strand)
Length: 166
Type: CDS
Source: GLEAN
Position: GCSC_113:2455505..2456106 (+ strand)
Length: 602
>GLEAN_4049 class=GenePrediction position=GCSC_113:2455280..2456106 (+ strand)
ATGCAAGCAACGGACGACAGCGCCACTCAGCTCGGACCAAAGGCAGCAAAGGGATCTCAGGTCTCCGTTTCGGTCCCCGT
CGGGTCTACTGATATCCACCTTTTCTATCTTTCCGAAAACAAGTCCTTGGCTTCCCTCACATTGAATGGAAGTGCATGGT
CGGCAGGTATGTTATGGTCCTATGATCCTACCGACTTTGTCTGACCACCACCATTGCAATTACAGTGCTTCCTCCTATAC
CAAAGTTTGCCTCGGATTCAAAGACCAGTTTTGCGGCTGCAGCCTGGGCGGAATCCTCCCTGATCGTCCGAATATTCTAC
ATCAACAGCGATAAAGTCACGAGCAAATGGACATTGTTGGATGGTGCTGAAGGATTCTGGGTTAACACAGCTGATACCAT
TGGCACAAGACCGGCAGCCAAGGCCAGTGAACCTGTCGCGGCATCACGAAGCGAAAATGGAACAGGGCGGTACTTGGAAT
ACTTTTACACCGCACCAGGAGGCCACATTAATTACTTGGCGAAGAACTATGTCGACGAACCCACGTTCCTGATTGAATAC
GCAAACTTTGAAATTCCCACTTCCGGTCTCACAAAAGACCAGAAGATCTCCCTTGGGACTGGTATTGTTGGTGGTGTTAT
TGGTATCGTATCTATAATTGTCGCCATAATCCTGGCAAAAGACAAATGGAAATGGCTGAGATGGTTTCGATTCTCCACGT
CCTCACAGAAGCAGGGCTATACACATGTGGCACCTGTTACCAGCGCCACAGCCATCAACAGAAACTCCCAAGGACCACCC
GTGCCGCATGCAACACTCCCTTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62